User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 8 12345 ... LastLast
Results 1 to 8 of 57

Thread: TC defects: The latest bugbear of CP growers?

  1. #1
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    TC defects: The latest bugbear of CP growers?

    I keep seeing this topic pop up in other threads rather than hijack those threads I decided to open a new one for a discussion of this.

    More and more of late I have been seeing what can only be described as an anti-TC movement among the CP community. And I am more than a little curious to know where this is coming from.

    I have seen numerous reasons put forth as to why TC is such an evil thing (some rational, some totally irrational) but the one that has been bugging me most of late is the one that states that TC and the chemicals used there in cause frequent and dramatic mutation/defects. Where is this idea coming from and how is it being perpetuated??

    I do not deny that TC mutations happen (we all know about cup trap and pom-pom and straw lid) but why do so many people jump right to "TC induced problem" as an answer when there seems to be something wrong with a plant??

    It is as if people are convinced that TC induced effects happen at the drop of a hat. This is not the case at all.

    I am more and more convinced that people are just jumping on a band wagon for no reason other than "it sounds good to me"... There was a similar rash of this a few years back where, whenever someone posted a picture of a plant, half the board would immediately ID it as some type of cultivar.

    I have been on these forums since the beginning and I have not met/seen many people here who have extensive or deep knowledge of TC. Yes, there are people here who do some home kit tinkering but there is a big difference between a home kit person who is a bit green and someone who has years of hands on experience.

    I have personally been involved with a professionally run TC lab for a number of years now and in that time I have deflasked (conservatively) hundreds of plants. In all that time and among all those plants I have not once come across any type of aberration/mutation/defect that could be said to be TC induced.

    So why is it that so many people believe that a mutation or an aberrant growth pattern automatically means the plant without a doubt came from TC and is suffering from the effects of exposure to the chemicals are used in that practice?

    Can someone please explain it to me?
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  2. #2
    scottychaos's Avatar
    Join Date
    Aug 2001
    Location
    Western New York, USA
    Posts
    2,970
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    well..I think its simple.

    if the majority of defects, such as most of the VFT mutated leaves, sawtooth, "bart simpson" cup-track, etc are all coming from TC plants, and are not coming from "naturally" propagated plants, then the obvious conclusion is "TC causes more mutations than seen naturally".

    I agree no one should assume ALL or ANY mutation is automatically a result of TC,
    because mutations do occur naturally...but its also obvious there has been a clear increase in the amount of mutations coming from TC plants.
    a much higher percentage than occur naturally.

    So why is it that so many people believe that a mutation or an aberrant growth pattern probably means the plant likely came from TC and is suffering from the effects of exposure to the chemicals are used in that practice?

    they believe that..well..because its true.

    Scot

  3. #3
    rattler's Avatar
    Join Date
    Oct 2003
    Location
    missing, presumed dead
    Posts
    8,554
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    TC lab for a number of years now and in that time I have deflasked (conservatively) hundreds of plants
    i would say you have deflasked hundreds of flasks but there have been thousands of plants........thats just going by whats been sent my way......

    without TC, most of us would not be able to afford most nep species, let alone get our hands on them a few years after discovery as has been the case a few times. without TC no way in hell would i experiment with VFT's the way i do for the hell of it more than anything..........are there occationally issues with TC plants? sure.......but the benifits FAAAAAR out weight the occational TC induced mutation
    cervid serial killer
    Know guns, know peace, know safety. No guns, no peace, no safety
    I didn't get stimulated but he kept his promise on change, that's about all I got left!
    http://www.wolfpointherald.com/--http://www.safety-brite.net/

  4. #4
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    But it is not true.

    Let us look at the VFTs closer since you cite them.

    but its also obvious there has been a clear increase in the amount of mutations coming from TC plants.
    This is not the case. Just because those mutants are common in the trade does not mean that they commonly occur in TC. I know of no onew ho has actually gone about the real time documentation of mutation occurrence in TC so you can not say that it is clear that there is an increase in the amount of mutations coming from TC. (Plus, on a personal note, if it is so obviously common, then why have I not seen anything in all the plants I have worked with in the past years??) How many times have those aberrant phenotypes occurred spontaneously? I do not know of any documentation on any except the "Bart Simpson" (which has only popped up the one time AFAIK.) What we have is a clear increase in the availability of the mutations on the market. So the reason we see so many of them is because once the trait is found it is then perpetuated. Not that the trait keeps popping up hundreds of thousands of times. People like the novelty of the cup-trap and "Bart" so the cup-trap and "Bart" have become independent clone lines, cup-trap is TC'd over and over and over to supply the demand and people are propagating the "Bart" as fast as possible for the same reason. I do not believe the sawtooth types are definitively TC mutants because some, I believe, are the result of selective breeding (I may be wrong on that.) The trait itself is also inherited so you can breed more sawtooth from a sawtooth line. Which, again, perpetuates and increases the numbers in cultivation but has no bearing on the actual occurrence in TC. To draw an analogy, albinism is not a common trait in snakes but go to a reptile show and every third animal you see is an albino... The trait is perpetuated because people like it. But if you take the time to actually track the parentage of those albinos then you find that they all trace back to a relatively few (in some cases a single pair) of progenitor animals.

    Also the TC mutants we have are well documented because we are such a small group and word of a novel form spreads fast. But just because something is "well documented" does not mean that it is common. There are genetic disorders that are extremely well documented down to the specific error in the pathway the gene is involved in, but the disorder itself has only been found in a dozen people worldwide. 1 in 600,000 is by no means wide spread but, to those people in that specific field, the disease is common knowledge.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  5. #5
    Whats it to ya? Finch's Avatar
    Join Date
    Feb 2004
    Location
    South Dakota
    Posts
    3,472
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Well TC is a huge method propagating many plants in the horticultural industry, from shrubs to some annuals. And I have never once heard anyone blame any mutations or problems on TC in the gardening community. In part it is because we cant tell what was tissue cultured and what was not. And far, far more plants are propagated using TC for the horticulture industry than for the CP hobby.
    that makes no logic

  6. #6
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by Finch View Post
    Well TC is a huge method propagating many plants in the horticultural industry, from shrubs to some annuals. And I have never once heard anyone blame any mutations or problems on TC in the gardening community.
    Indeed Finch and I was not going to bring that up as it seems a whole other can of worms. But it is very logical question, if people are so convinced that TC causes mutations then why do we not see gross abnormalities in things like orchids and ornamentals that are produced at significantly higher numbers than CPs??
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  7. #7
    OMG h8 pings MrFlyTrap2's Avatar
    Join Date
    Jan 2007
    Location
    DeKalb, IL
    Posts
    682
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I feel that it's up to the lab / person on how much he or she is willing to risk the induction of defects.

    If you want standard run of the mill plants, pick your traditional route.
    If you need hundreds of plants, you start adding chemical to induce the multiplication.
    If you are looking to expose a different trait in the plant, you pick another chemical trying for a mutation on purpose.

    Hell if you want to create one of those awesome potato / tomato hybrids, whip out the gene gun and fuse the buggers together.

    I'd say all of these different routes take different risks with mutation. Once a mutation occurs, the ethics / goal of the lab then is put into the spot light. You see the problem, but throwing it away = loss of product. When we are paying $125 for a < 3" N. Jamban, chucking anything out is a hard choice to make when you're looking at the bottom line.

    I have been on these forums since the beginning and I have not met/seen many people here who have extensive or deep knowledge of TC. Yes, there are people here who do some home kit tinkering but there is a big difference between a home kit person who is a bit green and someone who has years of hands on experience.
    They're here, you're just not looking hard enough.
    My Grow List

    "It is only by studying nature that can we ever hope to defeat it."

  8. #8
    Stay chooned in for more! Clint's Avatar
    Join Date
    Apr 2003
    Location
    Metro Atlanta Area
    Posts
    9,681
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    You don't know where it's coming from? It's coming from Hawaii!

    Some people have a cult-like devotion to seed grown plants, and it's as if they have a personal vendetta against TC. They aren't afraid to beat it into your head like Evangelicals, either!

    The bottom line is that people who talk about replacing TC'd plants with seed grown plants on a large scale are silly. I don't see things like N. clipeata, N. rajah, N. villosa, etc. flowering in cultivation every day, do you? These aren't even the $150 plants that people have to be put on waiting lists for! Then again, the bombastic ringleader of this movement DOES claim to have seed grown N. rajah. Too bad he refuses to post pictures of them because either he's lying or paranoid. But this isn't about him, I digress. It's just hard to seperate the two since they have become so intertwined.

    Do I think seed grown plants are bad? NO! Not at ALL! I believe we need MORE seed grown plants, but not at the expense of fewer TC'd plants. The reason is simple: More is just better! The idea of replacing TC with SG on a wide scale is a pipe dream. TC may not provide diversity, but it DOES provide stability and the assurance that you know what you're getting every time. On the off chance that a stable mutation does occur, it'll probably a good thing (Like Rob's fabulous variegated plants!)

    In summation, the idea of REPLACING non-cultivar TC with all seed grown plants is fanaticism. The idea of supplementing the hobby with more seed grown plants, without going off the deep end like some zealot and professing the need to replace the TC industry, is a Godsend. Fortunately we have people like EP and Sam ******* doing the latter, instead of the former which no one is doing anything about...except for COMPLAINING and preaching. Tissue culture does nothing but make the unobtainable obtainable to the hobbyist and the uncommon common to the consumer. Look at Dionaea. It's native to one tiny little spot in the world. It is a pretty rare plant if you look at it on a world-wide scale. Now with TC, they are a dime a dozen and anyone can buy, kill, and replace as many as they'd like without worry because there is, for all purposes, and UNLIMITED amount of the same thing, just like those subdivisions where each house is just like the next. As long as people keep shelling out money for their whiny kid to get one, and as long as we hobbyists keep buying them on sale and nursing them back to life, the unobtainable is obtainable for all.

Page 1 of 8 12345 ... LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •