User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 6 of 8 FirstFirst ... 2345678 LastLast
Results 41 to 48 of 62

Thread: It is NOT a pregnant man!!!

  1. #41
    herenorthere's Avatar
    Join Date
    Feb 2003
    Location
    almost Hartford
    Posts
    3,785
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Inspecting someone's privates or brain wiring is so 20th Century. The universally accepted test of gender is to spin people around three times, put them in a car in a strange place and see if they'll ask for directions.
    Bruce in CT

    Madness is something rare in individuals but in groups, parties, peoples, ages it is the rule. Friedrich Nietzsche

  2. #42
    Stay chooned in for more! Clint's Avatar
    Join Date
    Apr 2003
    Location
    Metro Atlanta Area
    Posts
    9,681
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Lmao. This reminds me of an episode of Southpark called Ms. Garrison's Fancy New Vagina:

    Ms. Garrison: But I paid five thousand dollars to be a woman. This would mean I, I'm not really a woman. I, I'm just a... a I'm just a guy with a mutilated *****!
    Doctor: Basically, yes.
    Mrs. Garrison: ...Oh boy, do I feel like a jackass.

    Lmao. Whoo. Alright. This person is a man because he identifies himself as a man. If I was a disembodied brain in a jar, I would still identify myself as a man. If I lost my genitals in some horrible accident, I'd still be a man mentally and genetically.

    But, physically, he is technically (notice I didn't say "really") a woman because he has a uterus and all of the parts and has an XX chromosome pair. That does not MAKE him a woman, that just means he has a uterus. Being a man or woman is a mental thing. What REALLY matters is who someone says they are inside. He was apparently happy enough to not have a complete sex change, but he's still no more or no less than a man than someone who had an operation or anyone born with a *****. I forgot whoever said it, but this is all about ignoring REAL news and getting people to watch. If they said 'A pre-op tranny's pregnant!" no one would really care, because that's not interesting. Is this really the first time this has happened? I bet it's not, but I guess they didn't have anything real to talk about... like Darfur or something.

    I never saw any hostility or anyone who's insecure with their sexuality :P It's so easy to say "You just don't agree with me because you secretly like boys" lmao. No one has said anything at all negative about transsexuals other than they don't think you can REALLY be a man/woman if you weren't born one (which raises questions about inter-sexed individuals... answer those for me ) and that's not good or bad. That's a neutral opinion. I just re-read the thread and saw where Josh called him "it".... this was a poor choice of words and pretty (very) insensitive, but he didn't mean anything by it IMO. Republicans don't generally think about political correctness; their thoughts just spew out without any sort of filter in between

    For the record, even if you don't think someone who's bio. a woman but mentally a man (or visca versa), I'd really hope you'd put your opinions aside and call them what they wished to be called, for the sake of not being a jacka ss. I feel really sympathetic to transsexuals (well, in general. I don't actually know any..... that I know of :P ) I can't begin to imagine how much harder their life is compared to someone who's "just" gay/bi, much less a straight person. And I bet it's REALLY hard for a Native American Wiccan transsexual with a peg leg! I don't think you can be more of a minority than that!

    EDIT: Why can we say Vagina but not P enis? Neither should be censored... human anatomy isn't vulgar (and people who mean to be vulgar don't say "p enis" anyway!)

  3. #43
    Doing it wrong until I do it right. xvart's Avatar
    Join Date
    Aug 2006
    Location
    Zone 8
    Posts
    5,594
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by Clint View Post
    For the record, even if you don't think someone who's bio. a woman but mentally a man (or visca versa), I'd really hope you'd put your opinions aside and call them what they wished to be called,
    I totally agree. I was just trying to point out that the arcane, age old "definition" of sexual identification is just that: arcane and not worth spit on the ground.

    xvart.
    "The tragedy of life is not that every man loses; but that he almost wins."

    "Quis custodiet ipsos custodes?"

  4. #44

    Join Date
    Apr 2006
    Location
    Cincinnati, OH
    Posts
    427
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Yes there are anatomical differences, such as the number of connectors from the left side to the right side of the brain and surely the use of different brain departments. However brains do not have gonads...
    Where do you think those brain differences, and gonads, come from? Differences in gene expression and developmental pathways.

    One doesn't hook up a baby to a brain monitor and analyze the usage of different brain areas to determine if the baby is male or female. This is absurd.
    Think of it this way: If you call any limbless reptile a snake, 99% of the time you'll be correct. And that quick, approximate definition is good enough for most people's needs. But that's not *actually* what defines a snake, and if you want to *actually* know for sure, you need to be more in-depth.

    The same thing here - 99% of the time (or more) the external matches the brain, so it's a useful first approximation, especially considering the cost for running a single fMRI scan. But every so other, you get the analog of a legless lizard - something that looks like one thing, but is something else.

    Mokele
    \"With malleus aforethought, mammals got an earful of their ancestor's jaw.\"
    --J. Burns, on the evolution of auditory ossicles.

  5. #45
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by Mokele View Post
    Think of it this way: If you call any limbless reptile a snake, 99% of the time you'll be correct. And that quick, approximate definition is good enough for most people's needs. But that's not *actually* what defines a snake, and if you want to *actually* know for sure, you need to be more in-depth.

    The same thing here - 99% of the time (or more) the external matches the brain, so it's a useful first approximation, especially considering the cost for running a single fMRI scan. But every so other, you get the analog of a legless lizard - something that looks like one thing, but is something else.

    Mokele
    Just because I feel like quibbling with someone over pointless minutia and because I know that Mokele can see and take my joke for exactly what it is, a joke :

    I think the ratio of legless lizard species vs. snake species is such that the assumption that a legless reptile is a snake would only be correct 97.386% of the time...

    And you are also assuming that all snakes are legless when it is a well known fact that on occasion boas and pythons will turn up that have legs. I guess that means they are not snakes??
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  6. #46

    Join Date
    Apr 2006
    Location
    Cincinnati, OH
    Posts
    427
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    My herp-fu is stronger!

    Limbless Armadillo-Lizards (Cordylids)
    \"With malleus aforethought, mammals got an earful of their ancestor's jaw.\"
    --J. Burns, on the evolution of auditory ossicles.

  7. #47
    Stay chooned in for more! Clint's Avatar
    Join Date
    Apr 2003
    Location
    Metro Atlanta Area
    Posts
    9,681
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I had one of those for a long time. An armadillo lizard I mean.

    Great pets. I've never seen one for sale except the one I had as a kid.

  8. #48

    Join Date
    Apr 2006
    Location
    Cincinnati, OH
    Posts
    427
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    They crop up from time to time on kingsnake.com classifieds, but never the legless species (which are almost unknown). They're often expensive, though, and almost never captive bred.
    \"With malleus aforethought, mammals got an earful of their ancestor's jaw.\"
    --J. Burns, on the evolution of auditory ossicles.

Page 6 of 8 FirstFirst ... 2345678 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •