User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 2 12 LastLast
Results 1 to 8 of 9

Thread: I swear Britain is loosing its friggin mind.....

  1. #1
    rattler's Avatar
    Join Date
    Oct 2003
    Location
    missing, presumed dead
    Posts
    8,554
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    I swear Britain is loosing its friggin mind.....

    http://new.edp24.co.uk/content/news/...A41%3A56%3A117

    Grandfather falls foul of knife law


    Colin Read with a knife similar to the one which was confiscated

    BEN KENDALL

    24 July 2008 06:41


    A Norfolk grandfather has become one of the most unlikely targets of the clampdown on street stabbings - after being arrested for carrying a pocket knife in public.

    Builder Colin Read was held for police questioning, had his fingerprints, DNA and mug-shot taken and was threatened with prosecution for carrying the knife which has been the tool of his trade for more than a decade. He believes he was the unwitting victim of a tightening of laws, following a series of tragedies across the country.

    The 64-year-old only realised that the blade, which measures less than three inches, was a banned weapon after visiting Norwich Magistrates' Court over a speeding matter - the first time in his life he has been in trouble. He voluntarily handed the knife to security guards only to be told they had no option but to call the police.

    Mr Read, from Hevingham, said: “I've never been in trouble or put a foot wrong with the law in my entire life until now. Now I've had to live with the stress of a potential jail sentence hanging over my head.”

    Home Office guidelines state that it is an offence to carry a knife in public without good reason - for example a chef carrying knives to work. The maximum penalty is four years in prison and a fine of £5,000.

    Knives where the blade folds into the handle, like a Swiss army knife, are not illegal, as long as the blade is shorter than three inches. This is because it would be difficult to use them to cause a serious injury. But those with a lockable blade - like Mr Read's - or Stanley and kitchen knives are banned.

    Mr Read has now been released with a caution but must still pay a costly legal bill and face a stain on his record. He spoke out last night to warn hundreds of people who legitimately carry knives - like farmers, fishermen, tradesmen and DIY enthusiasts - that they risk committing an offence every time they step out on the street.

    The case comes amid mounting calls for increased restrictions on knives. Gordon Brown acknowledged that too many people feel unsafe in their own homes as public concern about knife crime spirals; his comments followed a number of high profile deaths in street attacks.

    The Prime Minister said: “We need to make it absolutely clear to everyone, but especially young people, that in our country there are boundaries of acceptable behaviour, that it is completely unacceptable to carry a knife.”

    Mr Read said he used the knife for jobs like cutting packaging on building materials and testing wood while giving quotes.

    “I just walked into the court with it in my pocket as I was on my way to another job,” he said. “I was not threat to anybody - if I was why would I have handed it to the guards?

    “I understand the need to stop this kind of crime on the streets, but the authorities need to realise that people like builders, gardeners and agricultural workers have legitimate reasons to carry knives.

    “The police treated me with respect and I have no gripe with them for doing their job. But I feel there should be more flexibility in the law to allow for people to carry knives while going about their lawful business. This would have been commonsense years ago.”

    Mr Read said it was a relief to have received a caution but felt it was important to highlight the issue so that other members of the public do not fall foul of the law.

    A spokesman for Norfolk police said lock knives are prohibited and they had no option but to arrest Mr Read. Representatives of the Crown Prosecution Service were unavailable for comment.
    cervid serial killer
    Know guns, know peace, know safety. No guns, no peace, no safety
    I didn't get stimulated but he kept his promise on change, that's about all I got left!
    http://www.wolfpointherald.com/--http://www.safety-brite.net/

  2. #2
    Californian in DC DrWurm's Avatar
    Join Date
    Nov 2007
    Location
    DC Area
    Posts
    1,169
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Next to come.... Paperclip and toothpick regulations....

  3. #3
    Two flies one pitcher. Minus the crap eating. obregon562's Avatar
    Join Date
    Aug 2007
    Location
    Lakewood, California, USA
    Posts
    1,253
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    he should just carry a chain saw instead. Much safer to himself and the public, and no laws against them as far as i know.
    "It's easy to rip on cops, when you aren't the one needing saving"

    My Growlist

  4. #4
    War. War never changes. Est's Avatar
    Join Date
    Apr 2004
    Location
    Champaign, IL
    Posts
    3,935
    Mentioned
    3 Post(s)
    Tagged
    1 Thread(s)
    You know, there's a reason so many future-dystopia movies take place in the UK.

    http://www.backlash-uk.org.uk/
    ―\(Ί_o)/― ಠ_ಠ
    My Growlist
    NASC Website Come join in on the fun!

  5. #5
    Is ready to take this hobby to a whole new level DavyJones's Avatar
    Join Date
    Dec 2007
    Location
    Cleveland, Ohio
    Posts
    958
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by Est View Post
    You know, there's a reason so many future-dystopia movies take place in the UK.

    An excellent one many people have not seen is Brazil by Terry Gilliam. He was an old monty python guy. The movie is from the 80's and is a really dark dystopia film, but has some good humor in it too if youre quick enough to catch it. One of my favorite films, and one of my favorite film genres.
    "We are in a sense the Universe trying to understand itself. By Observing it we are observing what we are." - Phillip Plait

    Growlist: Updated 1/11/12 http://www.terraforums.com/forums/sh...d.php?t=110846

  6. #6
    swords's Avatar
    Join Date
    Apr 2002
    Location
    Cernunnos Woods
    Posts
    8,121
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    If lock knives are prohibited, they ought to go after the shops which sell them. That said, I'm a knife and sword collector, I haven't killed anyone but there are a few who have however, I'm not running the streets with them either they hang on my walls. Since guns are outlawed in the UK it only makes sense really that major crimes are commited by knifings so of course, the law has to come down on blades carried in public.

    This guy however is a bit like going to an airport with a knife and then crying cos you get arrested, don't go into federal buildings with weapons, dumb$!%^!

  7. #7
    herenorthere's Avatar
    Join Date
    Feb 2003
    Location
    almost Hartford
    Posts
    3,785
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    There needs to be a limit, but a 3" lockblade shouldn't be beyond it.
    Bruce in CT

    Madness is something rare in individuals — but in groups, parties, peoples, ages it is the rule. Friedrich Nietzsche

  8. #8
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Funny, this actually reminds me of high school when I got busted for the exact same thing...

    I have always loved knee-jerk reactions. I especially loved having my laser pointer and nail clippers taken away from me at the airport... I mean seriously!!
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

Page 1 of 2 12 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •