User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 3 of 4 FirstFirst 1234 LastLast
Results 17 to 24 of 28

Thread: Happy Birthday to Pyro!

  1. #17
    swords's Avatar
    Join Date
    Apr 2002
    Location
    Cernunnos Woods
    Posts
    8,120
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Happy Birthday - don't ban me - send me some free plants!


    J/K hope you have a great day man!

  2. #18
    Loves VFT's! Trapper7's Avatar
    Join Date
    Feb 2005
    Location
    Slowly drifting out to sea...
    Posts
    3,036
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Happy Birthday Pyro! Hope you're having a good day!
    Great Googly Moogly!

    Beware of the yellow snow!

  3. #19
    Aklys joossa's Avatar
    Join Date
    May 2006
    Location
    Palmdale, CA, USA
    Posts
    2,043
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Happy birthday!

    Can you make me some BGH via PCR? Thanks.
    -Joel from Southern California


  4. #20
    Jimmy's Avatar
    Join Date
    May 2008
    Location
    USAF Academy, CO
    Posts
    593
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Happy Birthday Pyro!

  5. #21
    D_muscipula's Avatar
    Join Date
    Aug 2007
    Location
    Oregon
    Posts
    1,500
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Happy B-Day dude!
    view my growlist
    http://grwlist.notlong.com

  6. #22
    Hello, I must be going... Not a Number's Avatar
    Join Date
    Nov 2006
    Location
    Los Angeles, CA
    Posts
    7,506
    Mentioned
    5 Post(s)
    Tagged
    0 Thread(s)
    Happy Birthday Travis. This is certainly a milestone summer for you. Have the time of your life.
    Grand Hotel... always the same. People come, people go. Nothing ever happens.

  7. #23
    trek623's Avatar
    Join Date
    Jul 2007
    Location
    Tennessee
    Posts
    188
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    happy birthday! i hope you receive as much as you have given, although i don't think that that is possible! have a good one!

  8. #24
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Thanks all for the well wishes. Was pretty much just another day for me (you get to a point where you just don't care you know LOL) But I did decide to open the doors for mockery. Below is a pic of me wearing the "gift" from my father-in-law, picked up on one of his trips to Mexico...



    The funny thing is that I was sober when I put the thing on and allowed the picture to be taken
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

Page 3 of 4 FirstFirst 1234 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •