User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 2 of 6 FirstFirst 123456 LastLast
Results 9 to 16 of 48

Thread: the evolutionary advantage of religion

  1. #9
    allegedhuman's Avatar
    Join Date
    Jan 2008
    Location
    Michigan
    Posts
    307
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    This brings to mind a book I read a while ago called "The Origin of Consciousness in the Breakdown of the Bicameral Mind". Part of the claim of the book was that religion was the results of the two hemispheres in the brain working independently of each other early in human history. One hemisphere in charge of decision making and the other in carrying out those decisions. Apparently the half of the brain that said "hey do this" was perceived as a god or something like that and religion is derived from that. Kinda an interesting and weird book if anyone really wants to read through it. Sorry if I massacred the synopsis of the book if anyone remembers it better than me...it has been a while but I thought if anyone was really interested in the topic of the science behind religion this would be something I'd suggest. Plus there is all kinds of painful philosophical discussion behind was exactly is consciousness and other deep things like that. I know I skipped most of that

  2. #10

    Join Date
    Apr 2006
    Location
    Ft. Worth, TX
    Posts
    2,251
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Z polski y dumny
    Prayer - how to do nothing and still think you're helping.
    http://www.youtube.com/watch?v=5F5aCUNE4Z8
    ^^^Newest vid

  3. #11

    Join Date
    Apr 2006
    Location
    Cincinnati, OH
    Posts
    427
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I haven't been able to find the original article, but I found this:
    http://homoeconomicusnet.wordpress.c...-and-religion/

    The hypothesis, apparently, is that in areas with lots of diseases, anything that prevents group intermingling, including religious taboos, will be stronger, and thus there will be more religions in such areas.

    Honestly, I can think of several huge problems with that right away, including whether or not they actually quantified how religion (or particular ones) affects movement, whether or not the diseases are even affected by movement (for instance, group interaction or lack thereof will have no effect on mortality due to the most deadly historical disease, malaria or any other vector-borne pathogen), and whether or not the number of religions is actually a Product of disease limiting the group size and thus leading to divergences in beliefs.

    herenorthere, can you send me the PDF - I don't seem to have access to the current issue yet.

    Mokele
    \"With malleus aforethought, mammals got an earful of their ancestor's jaw.\"
    --J. Burns, on the evolution of auditory ossicles.

  4. #12
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Ditto Mokele's request for me herenorthere
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  5. #13
    Agent of Chaos Wolfn's Avatar
    Join Date
    May 2008
    Location
    Florida
    Posts
    1,407
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I'm a devout Muslim, and I'm perfectly fine with my religion
    "I may be on the side of angels, but do not mistake me for one."

    Wolfn's Growlist

  6. #14
    herenorthere's Avatar
    Join Date
    Feb 2003
    Location
    almost Hartford
    Posts
    3,785
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    A lot of anthropologists have written about how religion/superstition can benefit society. The underlying premise is that if having religion/superstition didn't provide an advantage, humans wouldn't have them. For instance, a ban against incest would have been beneficial for a group having the prohibition, even if they had no understanding of the reason. Similarly, the desert religions' ban against pork would have forced people to focus on animals better suited for that environment. I finally found the full religion-evolution article, but I had too much reading at work today and will get to the article another day.
    Bruce in CT

    Madness is something rare in individuals but in groups, parties, peoples, ages it is the rule. Friedrich Nietzsche

  7. #15

    Join Date
    Apr 2006
    Location
    Ft. Worth, TX
    Posts
    2,251
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Similarly, the desert religions' ban against pork would have forced people to focus on animals better suited for that environment.
    Actually pigs are very suited to that (and almost all other) environment(s). Pigs can live almost anywhere and eat almost anything, they have nutritious and delicious meat, their bones and organs can be used for a variety of uses, etc. It would be very cruel of a god to make such a useful animal and not let anyone touch it .

    The trichinosis reasoning for pork being banned is nothing but a myth. The only reason pork was banned in Judaism is that as luck would have it, we tend to taste like pig. Even the cannibal vernacular for "human" in the indigenous tribes of PNG translates to "long pig". It's also the blood-curdling scream of pigs being slaughtered that reminds people of...well...us. There are and were no inherent health reasons not to eat pigs, besides the fact that Jews were uncomfortable with it since it apparently is reminiscent of human. So somewhere down the line, someone (human) decided that it would be off limits. In fact, when that area of the world was much more of a mosaic of religions and cultures than it is now, Jews were the only ones that didn't eat pork. Anthropologists actually are able to identify Jewish settlements because they were the only ones that contained no pig bones. Somewhere along the line (much, much further down the line), Muslims, who used to eat pork, adopted a *distinctly* Jewish tradition. However, Muslims somehow don't see this as ironic.

    Read "A Short Digression on the Pig" in God is not Great for the full story.

    It's sort of like the Hindus and cows thing. I forget what flowery story they tell you about how cows are holy blah blah blah, but the reasoning behind this is similar. Somewhere along the line, one of the rulers of that area decided that cows were to be "holy" and unable to be eaten solely for the reason that when peasants were starving in the winter and whathaveyou, they wouldn't eat their only source of income.
    Z polski y dumny
    Prayer - how to do nothing and still think you're helping.
    http://www.youtube.com/watch?v=5F5aCUNE4Z8
    ^^^Newest vid

  8. #16
    白人看不懂 Drosera36's Avatar
    Join Date
    Aug 2004
    Location
    z5/6, Rochester, NY
    Posts
    2,017
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I was always told that the reason that certain cultures don't eat pig is because they are dirty animals, which makes sense, although that could be a "cover up"? lol

    And I think the same goes for dogs in Islam; they cannot be kept in the home, but can be used as guard dogs, and this is because they are dirty. Or something like that. I could be wrong.

    -Ben
    He who can, does. He who can't, teaches. -George Bernard Shaw
    I love these shirts!!!
    My Growlist
    My Webpage

Page 2 of 6 FirstFirst 123456 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •