User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 4 of 6 FirstFirst 123456 LastLast
Results 25 to 32 of 48

Thread: the evolutionary advantage of religion

  1. #25
    Hort. School dropout X 2
    Join Date
    Mar 2006
    Posts
    1,276
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Ahmad,
    you said in an earlier post
    >>>>>Pigs don't have a throat to slit, so that's another reason why we don't eat them.<<<<
    I beg to differ with you. I am a long time farmer's daughter and my father slit many a pig thoat when I was growing up on eclectic farm,( milking cows, pigs, chickens and an occasional duck, grain crops, oats, wheat hay, )
    I agree with them wallowing in their own filth and having parasites. trichinosis is one that they are famous for.
    LMO
    Every seed that you plant ,doesn't sprout.
    Every seed that sprouts, doesn't make it to maturity.
    Every cutting that you stick doesn't grow roots.
    Every cutting that roots doesn't grow to a small plant.
    Every small plant doesn't reach maturity.


    Who needs speelcheck?

  2. #26
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by herenorthere View Post
    A lot of anthropologists have written about how religion/superstition can benefit society. The underlying premise is that if having religion/superstition didn't provide an advantage, humans wouldn't have them.
    It is possible for such an idea to exist and perpetuate while not conferring any advantage. Ideas/thoughts/beliefs/etc have their own discreet evolutionary unit dubbed a "meme". A meme is basically the thought equivalent of a gene. And in the same way that some DNA has become parasitic in nature (i.e. viruses) some memes have the ability to become parasitic and thereby remain in existence, self-perpetuating but conferring nothing beneficial to the "host".
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  3. #27
    Moderator Alexis's Avatar
    Join Date
    Sep 2001
    Location
    Manchester, UK
    Posts
    956
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Islam teaches us to be kind to animals. There's a story of the Prophet Muhammad (SAW) that a cat was sleeping on his robes, and he cut out a hole in his robes around the cat so he could get up without waking the cat.

    There's another story about a man who was traveling, and when he saw a thirsty dog, he filled his shoe with water and gave it to the dog to drink. Muhammad (SAW) said this man was granted Paradise for his good deed.
    Excellent.

    What about halal though? That doesn't exactly fit in with this paragraph?

  4. #28
    rattler's Avatar
    Join Date
    Oct 2003
    Location
    missing, presumed dead
    Posts
    8,554
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Pigs don't have a throat to slit, so that's another reason why we don't eat them.
    no offence but beef cattle's throats arent slit in order to kill them....a bolt is fired into the brain(or if your on the farm a 22 is usually used).....you have any clue how dangerous it is to try to slit the throat of an 800-1200 pound year old cow while it is hanging upside down?.....its so dangerous as to be stupid....same with a hog or most anything over about 50 pounds.......i wouldnt attempt it on the 100 pound speed goats i hunt let alone a hog or beef.........
    cervid serial killer
    Know guns, know peace, know safety. No guns, no peace, no safety
    I didn't get stimulated but he kept his promise on change, that's about all I got left!
    http://www.wolfpointherald.com/--http://www.safety-brite.net/

  5. #29
    --Freedom Czar-- Fryster's Avatar
    Join Date
    Apr 2007
    Location
    z5/6, Lansing, MI
    Posts
    1,010
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    The phrase, "evolutionary advantage of religion" is kinda peculiar I think and opens the mind to some different kind of ideas.

    But I'd like to see/read some articles on something like, "the religious advantage of the theory of evolution". I bet some people have never thought of Mr. Darwin like that before...
    Only a moral and virtuous people are capable of freedom; the more corrupt and vicious a people becomes, the more it has need of masters. -- Benjamin Franklin

  6. #30
    Agent of Chaos Wolfn's Avatar
    Join Date
    May 2008
    Location
    Florida
    Posts
    1,407
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by flytraplady5 View Post
    Ahmad,
    you said in an earlier post
    >>>>>Pigs don't have a throat to slit, so that's another reason why we don't eat them.<<<<
    I beg to differ with you. I am a long time farmer's daughter and my father slit many a pig thoat when I was growing up on eclectic farm,( milking cows, pigs, chickens and an occasional duck, grain crops, oats, wheat hay, )
    I agree with them wallowing in their own filth and having parasites. trichinosis is one that they are famous for.
    LMO

    Well someone told me about pigs not having throats to slit. But even still, they are filthy animals.

    Someone told me that if you take fresh pig meat and pour Coka-Cola on it, you'll see all sorts of worms and parasites start crawling out of it.

    Quote Originally Posted by Alexis View Post
    Excellent.

    What about halal though? That doesn't exactly fit in with this paragraph?

    'Halaal' means allowable. For example, sea-food is "halaal", yet pig meat is "haraam".

    Quote Originally Posted by rattler_mt View Post
    no offence but beef cattle's throats arent slit in order to kill them....a bolt is fired into the brain(or if your on the farm a 22 is usually used).....you have any clue how dangerous it is to try to slit the throat of an 800-1200 pound year old cow while it is hanging upside down?.....its so dangerous as to be stupid....same with a hog or most anything over about 50 pounds.......i wouldnt attempt it on the 100 pound speed goats i hunt let alone a hog or beef.........


    To tell the truth, Muslims are not allowed to eat meat that hasn't been killed in the correct Islamic way. So I'm honestly not allowed to go to McDonalds and order a burger because that beef wasn't killed in the correct Islamic way.

    I won't lie, I occasionally eat beef and chicken that hasn't been killed Islamically.

    (please don't tell anyone )
    "I may be on the side of angels, but do not mistake me for one."

    Wolfn's Growlist

  7. #31

    Join Date
    Apr 2006
    Location
    Ft. Worth, TX
    Posts
    2,251
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Someone told me that if you take fresh pig meat and pour Coka-Cola on it, you'll see all sorts of worms and parasites start crawling out of it.
    100% false.

    For example, sea-food is "halaal"
    Unless you're (hanafi?) shia and only think shrimp and fish with scales are ok...

    So I'm honestly not allowed to go to McDonalds and order a burger because that beef wasn't killed in the correct Islamic way.
    For some reason, there actually are McDonald's with halal meat, and I think a few have 100% halal menus. The funny thing about halal meat, is that most of it....isn't. As rattler said, you can't hang a cow upside down, etc. Even some halal meat plants have admitted to not saying "bismallah" (spelling?) before killing every single animal, and most halal meat plants use machines to do the killing. Lots of places have been found to not be clean enough, etc, etc. I think this is the story I watched: http://www.youtube.com/watch?v=txoxtcvehCA
    Then there's the whole 'is kosher halal'? Debate, etc, etc.

    Of course there are multitudes of Muslims that disagree with each other on pretty much every aspect of what I just said. Very ironic for a religion that claims to know absolutely everything, and demands that it is undebateable .

    Anyway, relating this to the topic, I've never seen any proof to show that kosher or halal products are any cleaner or more healthful, as compared to non-kosher/halal products. Europe has always been largely pagan and later christian, and Europe has more often than not been the most powerful/advanced region on the planet (for the past ~2000 years. PS: I'm not saying Europe was powerful because of religion). You've got the Greeks, Romans, Russians, Austrians, English, Prussia, USA (largely Euro settlers), etc, etc, etc, as compared to the Turks and Persians. The Mongols made very quick work of the Turks, and the Mongols would be included in people that never had strict dietary restrictions. So, not only did those not adhering to such totalitarian restrictions not weaken and/or die, but they have more often than not been the strongest on the planet since about 100AD.
    And bonus points to the Teutons for inventing beer in 800BC.
    Z polski y dumny
    Prayer - how to do nothing and still think you're helping.
    http://www.youtube.com/watch?v=5F5aCUNE4Z8
    ^^^Newest vid

  8. #32
    swords's Avatar
    Join Date
    Apr 2002
    Location
    Cernunnos Woods
    Posts
    8,121
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Sure religion can infer an advantage, you kill the non-believers, hence the only ones left are believers... or liars. That's been happening for millenia.

    It's only been in the last few hundred years that people and scientists who don't believe have been able to speak their minds, in the old days... Let's just say there were no good old days for non-believers thanks to the kind and loving hands of "god's army".

Page 4 of 6 FirstFirst 123456 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •