User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 5 12345 LastLast
Results 1 to 8 of 35

Thread: Brewing, microbes, and yeast... oh my!

  1. #1

    Join Date
    Apr 2006
    Location
    Ft. Worth, TX
    Posts
    2,251
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    What exactly does live in beer besides yeast? Not what can, but what does. The pH is quite low, alcohol content high enough (up to 15% in some common styles), and yeast makes it rather inhospitable to anything else. I've heard there may be "possible" things living in lambic styles, but not too many (and lambics aren't very common anyway). Homebrew isn't nearly as sophisticated as the megabreweries, and I'd find it hard to think of anything that could possibly live in even homebrew. Not only is everything diligently sterilized (if you're good at it), but the wort is boiled, which kills of anything. Then, even if something airborne landed in your wort while racking to secondary or something, it wouldn't be able to survive in the aforementioned conditions, especially since the yeast population would've exploded by that point.

    Posts moved from here. Obviously I created a sort of lame title, so if there are any other suggestions, let me know... -xvart.
    Last edited by xvart; 08-12-2008 at 08:27 PM.
    Z polski y dumny
    Prayer - how to do nothing and still think you're helping.
    http://www.youtube.com/watch?v=5F5aCUNE4Z8
    ^^^Newest vid

  2. #2
    rattler's Avatar
    Join Date
    Oct 2003
    Location
    missing, presumed dead
    Posts
    8,554
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    15%? WTF are you drinking? very few are that high.....unless your drinking god aweful "malt liquor".......most styles of beer fall between 3% and 9% even homebrews are mainly in that range.........and Pyro corrected me and said microbes and such CAN live in beer, not that they DO and he is correct......just like ppl are wrong when they say honey is sterile, its not, the sugar content is just high enough to prevent things that land on it from growing.....however they can sit there dormant till the honey is diluted....
    cervid serial killer
    Know guns, know peace, know safety. No guns, no peace, no safety
    I didn't get stimulated but he kept his promise on change, that's about all I got left!
    http://www.wolfpointherald.com/--http://www.safety-brite.net/

  3. #3

    Join Date
    Apr 2006
    Location
    Ft. Worth, TX
    Posts
    2,251
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    WTF are you drinking?
    Maibock, barley wine, strong pale ale, etc. Lots of styles routinely go above 9%. Lots of bocks...eisbock, and so forth.

    I'm sure there are lots of things that could live in beer. Bacteria are pretty adaptable...I just want to know what does. What can doesn't concern me if it won't be able to take hold.
    Z polski y dumny
    Prayer - how to do nothing and still think you're helping.
    http://www.youtube.com/watch?v=5F5aCUNE4Z8
    ^^^Newest vid

  4. #4
    rattler's Avatar
    Join Date
    Oct 2003
    Location
    missing, presumed dead
    Posts
    8,554
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    unless yah leave a beer open on the counter for a couple days there is no issue......all kinds of things can live in beer(though there are no known pathogens) if homebrew gets infected with some bacteria you almost always dump it cause it tastes horrible, though is in all reality prolly "safe" to drink.....true lambics(and not those that most home brewers attempt) are prolly using 20 or more different strains of bacteria naturally occurring in and around the brewery......the best home brewers package of lambic cultures i can come up with only sell about 5 strains of bacteria......since bacteria are doing the fermentation and not so much yeasts the fermentation process takes a year or more and the end product is usually low in alcohol(i think 3-5%).............basically comes down to if the beer tastes fine its safe to drink..........bacteria wise........
    cervid serial killer
    Know guns, know peace, know safety. No guns, no peace, no safety
    I didn't get stimulated but he kept his promise on change, that's about all I got left!
    http://www.wolfpointherald.com/--http://www.safety-brite.net/

  5. #5

    Join Date
    Apr 2006
    Location
    Ft. Worth, TX
    Posts
    2,251
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I thought lambics were supposed to be done w/ wild yeasts?
    Z polski y dumny
    Prayer - how to do nothing and still think you're helping.
    http://www.youtube.com/watch?v=5F5aCUNE4Z8
    ^^^Newest vid

  6. #6
    rattler's Avatar
    Join Date
    Oct 2003
    Location
    missing, presumed dead
    Posts
    8,554
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    its more bacteria than yeasts by far, yeasts play some part of it but the long fermentation process comes from the fact the bacteria that are present and are specifically intended to be a part of the process need lots of nutrients and time(the best im told age/ferment for several years)....if you added most cultivated yeast strains the alcohol content gets to high and the bacteria are killed off....im sure most of the alcohol present is from the wild yeasts but the traditional lambic flavors come from the bacteria.....

    Today the beer is generally brewed from a grist containing approximately 70% barley malt and 30% unmalted wheat. When the wort has cooled, it is left exposed to the open air so that fermentation may occur spontaneously. While this exposure is a critical feature of the style, many of the key yeasts and bacteria are now understood to reside within the brewery and its (usually timber) fermenting vessels in numbers far greater than any delivered by the breeze. Up to 86 microorganisms have been identified in Lambic beer, the most significant ones being Brettanomyces bruxellensis and Brettanomyces lambicus. The process is generally only possible between October and May as in the summer months there are too many unfavourable organisms in the air that could spoil the beer.
    also lambic beer normally contains no hops for flavoring....but may have some older ones that have diminished bitterness added as a preservative.....
    cervid serial killer
    Know guns, know peace, know safety. No guns, no peace, no safety
    I didn't get stimulated but he kept his promise on change, that's about all I got left!
    http://www.wolfpointherald.com/--http://www.safety-brite.net/

  7. #7
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Rattler is correct that I was more getting at the "can" side than the "do" but beer (even commercial beer) is by no means sterile. There are many beers sold with the yeast still active in them, and that is after the whole boiling and pasteurization process. And yeast really are not that robust as far as microorganisms are concerned so if they are alive then you can bet there are bacterial alive as well.

    As for the conditions mentioned, the pH and EtOH are not even close to inhibitory levels for even common bacteria. Acetobacter happily thrive under those conditions (and are even used acidify beers further as in sour ales). They also tend to be the culprits for turning wine into vinegar and whine has a higher EtOH content than beer.

    Additionally the presence of the yeast is not in and of itself inhibitory to the presence/growth of other organisms. While they may consume the most easily available resources faster because of their greater numbers there are plenty of other resources available for use, including the metabolic byproducts from the yeasts.

    If you want specifics as to what all can be/is in beer I can not list them off hand because I have not researched it in detail (does not exactly fall under the umbrella of my funding LOL...) In point of fact I seriously doubt anyone has tried to get a complete census because, as I noted, they are not pathogenic and therefore are not of consequence to the world at large. And if they are not of consequence then no one wants to fund research into them... I am sure a little bit of websurfing will turn up some of the organisms known but considering the vast majority of microorganisms are not amicable to laboratory cultivation an entire census is only just now be possible... To someone who happened to have a couple million dollars and the latest generation of sequencing machinery just laying around (assuming this same person also had the technical prowess to run the experiments...)
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  8. #8
    herenorthere's Avatar
    Join Date
    Feb 2003
    Location
    almost Hartford
    Posts
    3,785
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    A proper Lambic not only has wild yeasts; it also is fermented in open, aerobic conditions and that has a big impact on the flavor too. American brewers can't do that on a commercial scale. I've heard of home brewers approximating the effeect by using an aquarium bubbler to aerate the beer in secondary fermentation, but it's hit or miss and it's a risk. If you get samples from home-brewing friends who are a little too sloppy, you've probably had some experience with what alien microbes can do to a beer and none have killed me yet. It's a lesson that other things can thrive in beer. The best indicator is a white ring on the glass around the surface of the liquid in the bottle. When you see that, something else is in there.

    The main Belgian wild yeasts are Brettano... something and beers made with them are bretts. I had one that tasted like the liquid seeping from the straw at the bottom of a horse stall, or how I would imagine it tasting and, given what it cost, I made a valiant effort to finish the full 25 oz. I made it to ~20 and just couldn't take another sip. I told a friend who's way into beer and he said it went great with smoked Gouda. I can't imagine. Other bretts are pretty darn good, but they're an acquired taste and it's hard to know what you're getting. The best and worst I've had are from the same brewer and have the same name (Flemish Primitive Wild Ale), with the only difference being the art on the label. I have a couple bretts in the basement now, with one being a good FPWA and the other being Ommegang Brewery's Ommegeddon. They can't brew that in the authentic, open air manner here. From what I've heard, they ferment the beer with more conventional yeast and add a shot a brett yeast right before bottling it.
    Bruce in CT

    Madness is something rare in individuals but in groups, parties, peoples, ages it is the rule. Friedrich Nietzsche

Page 1 of 5 12345 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •