User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 3 of 5 FirstFirst 12345 LastLast
Results 17 to 24 of 33

Thread: In the Name of Science!

  1. #17
    trainspotting's Avatar
    Join Date
    Oct 2004
    Location
    Davis, California
    Posts
    130
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I don't think cloning in this sense would bring back the species, similarly it would be of limited use to save endangered species. With only limited samples of individual's DNA there would not be anywhere near enough genetic diversity for thriving in situ. But maybe if a large catalog of DNA was gathered it could work... the penguin gene bank...
    Im a terible speeler, but I are collage stodint.
    "Is God willing to prevent evil, but not able? Then he is not omnipotent
    Is he able, but not willing? Then he is malevolent
    Is he both able and willing? Then whence cometh evil?
    Is he neither able nor willing? Then why call him God?" -Epicuris

  2. #18
    Doing it wrong until I do it right. xvart's Avatar
    Join Date
    Aug 2006
    Location
    Zone 8
    Posts
    5,594
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by swords View Post
    I think it's high time for some optimistic research into longevity, cloning and other bio-science instead of continuing the proliferation of megadeth.
    Quote Originally Posted by swords View Post
    I can't remember much else but I'm not talking about Encino Man with Polly Shore! lol!
    Sounds like you are talking about two of Polly Shore's classics: Biodome and Encino Man!

    Quote Originally Posted by swords View Post
    However, to continue the discussion from the body worlds post, what assurance do we really have that the Neanderthals want to be resurrected?
    Of course they want to be resurrected! How could they not? You know they want to watch some cave man insurance commercials on a plasma screen while listening to their iPod!

    xvart.
    "The tragedy of life is not that every man loses; but that he almost wins."

    "Quis custodiet ipsos custodes?"

  3. #19
    swords's Avatar
    Join Date
    Apr 2002
    Location
    Cernunnos Woods
    Posts
    8,120
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I think its interesting that first you question if they would have the ability to culturally learn how to deal with modern life, even though they clearly had a complex culture of their own. I think its interesting that you feel it may be mentally challenged even though we have no good way to measure how intelligent or not they were. Though they may have an issue with how hot the earth has gotten since they were last around, and they will probably miss hunting the friendly little cave bears. LOL.
    Come now, let's not fight over here too. I'm all for having my naive assumptions destroyed, bring on the cave boy! Once again, we're actually on the same side, for Bear God's sake! lol!

    Sounds like you are talking about two of Polly Shore's classics: Biodome and Encino Man!
    Geez, did Polly do a movie called Biodome too? That little frizzy haired twerp is gonna haunt me to the grave!

  4. #20
    Doing it wrong until I do it right. xvart's Avatar
    Join Date
    Aug 2006
    Location
    Zone 8
    Posts
    5,594
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by swords View Post
    Geez, did Polly do a movie called Biodome too? That little frizzy haired twerp is gonna haunt me to the grave!
    According to my roommate my Sophomore year of college, it is "allegedly" a classic. He literally would come home everyday after Architecture studio and watch it... Everyday...

    xvart.
    "The tragedy of life is not that every man loses; but that he almost wins."

    "Quis custodiet ipsos custodes?"

  5. #21
    swords's Avatar
    Join Date
    Apr 2002
    Location
    Cernunnos Woods
    Posts
    8,120
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I went to school most of my school life with a guy who acted like Polly Shore / Jar Jar Binks (Polly in star wars) long before there ever was a Polly or Jar Jar.
    I might have had a 2 foot tall mohawk or other bizarre look through school but being around that guy was plain embarrassing! lol!

  6. #22
    Tropical Fish Enthusiast jimscott's Avatar
    Join Date
    Nov 2003
    Location
    Western New York
    Posts
    18,768
    Mentioned
    1 Post(s)
    Tagged
    0 Thread(s)
    Look at this way... at least we would be able to have real cavemen do the commercials.

  7. #23

    Join Date
    Sep 2002
    Location
    Michigan
    Posts
    747
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by jimscott View Post
    Look at this way... at least we would be able to have real cavemen do the commercials.
    Thats so condescending to think they would lower themselves to being mere actors for our entertainment. LOL.
    "We're terrible animals. I think that the Earth's immune system is trying to get rid of us, as well it should." - Kurt Vonnegut

  8. #24
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by Dimka View Post
    I'm pretty sure they'll be able to replicate the DNA from them (they've already taken it apart and determined they had red hair and green-brown eyes)
    I have exactly one thing to say to this:




    As for the idea of cloning a Neandertal... I would not worry much about it happening anytime soon. This article goes a great gloss job to jump from Mammoth genome to Neandertal cloning. The truth of the matter is that only about 70% of the Mammoth genome was able to be sequenced (This is the largest amount of nuclear DNA from any ancient creature [and yes that includes Neandertals] to ever be sequenced) which leave a huge chunk unknown. Too large to even think about trying for a Mammoth. This article purposefully distorts the facts to then bend it around and make an ethical debate and that is absolutely idiotic.

    If you want to get your science news please get it from an actual scientific source (Science, Nature, Cell, PubMed, etc) rather than an editorial...
    Last edited by Pyro; 11-25-2008 at 10:43 AM.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

Page 3 of 5 FirstFirst 12345 LastLast

Similar Threads

  1. yellow science
    By phissionkorps in forum General Discussions
    Replies: 30
    Last Post: 06-29-2008, 11:08 AM
  2. I'm going to study zoo science!
    By Warlock in forum General Discussions
    Replies: 9
    Last Post: 03-30-2005, 12:59 PM
  3. In the interest of science....
    By schloaty in forum Sundews (Drosera), Byblis, Drosophyllum
    Replies: 3
    Last Post: 01-24-2004, 03:45 PM
  4. Science project
    By monkeyman in forum General Discussions
    Replies: 2
    Last Post: 02-05-2003, 07:13 AM
  5. science project
    By froggie2007 in forum Venus Flytrap (Dionaea ) Care Information & Tips
    Replies: 3
    Last Post: 08-24-2002, 10:27 PM

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •