User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 2 of 4 FirstFirst 1234 LastLast
Results 9 to 16 of 26

Thread: The StarChild Skull

  1. #9

    Join Date
    Sep 2002
    Location
    Michigan
    Posts
    747
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Yup, it looks like a severly deformed human skull. Intentional modification of the skull shape is very common among humans. Andean cultures, Mesoamerican cultures, and South Eastern US cultures all participated in it. They all created slightly different shapes as well. This skull could easily be the result of a poorly performed cradle boarding hence the reason it doesnt look very good.

    The DNA testing is BS. PCR replication is not reliable on ancient skeletons. In fact it is fairly iffy on anything that is more than about 50 years old, and thats if it has received proper curatiation. There is no archaeological context or associated material. Everything else just happened to be lost in a conveient flood even though they had survived for 900+ years according to the site. The morphological changes like muscle attachments appear to be a result of the deformation to the skull, as they would alter along with shape. Sagital suture is as good as rolling dice when it comes to age estimates past about 3 years old. And these are all the problems I found just skimming the stuff. Please show me something actually scientific.
    "We're terrible animals. I think that the Earth's immune system is trying to get rid of us, as well it should." - Kurt Vonnegut

  2. #10
    swords's Avatar
    Join Date
    Apr 2002
    Location
    Cernunnos Woods
    Posts
    8,120
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    im going with stoned.....either on pot or acid
    I should think either chemical would produce a better name than Starchild, that was Paul Stanley's character name in the KISS and the Phantom of the Park movie. lol!

  3. #11
    swords's Avatar
    Join Date
    Apr 2002
    Location
    Cernunnos Woods
    Posts
    8,120
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Ktulu,
    I'm surprised that there were so many cranium altering cultures, I'd only seen pics of the corn-god coneheads. I wonder how that sort of thing affected peoples mental development. Obviously if they grew up to be boy-kings (Tut) it wasn't immediately perilous physically but I wonder how emotions or other mental processes could be altered by these kinds of procedures? Are there any cultures doing this now? Were only certain people selected for this "cranial readjustment"?

  4. #12

    Join Date
    Sep 2002
    Location
    Michigan
    Posts
    747
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Swords,
    There are many more cultures than I mentioned that did this, I know there are some old world cultures that did cranial deformation but I just don't remember which ones, though South East Asia comes to mind for some reason, but that is a total guess. I do not believe it affected the mental capacity of the individuals that underwent it in any measurable way. It appears the brain just reorients its self in the skull and should only have negligible affects on mental capacity. Diet likely had a bigger impact on their brain development than cradle boarding, as this process must be started within weeks of being born for it to be truly effective. I believe the biggest risk is wrapping the child's head too tightly until gray ooze comes out their ears, though the high plasticity of the human skull before the plates begin to fuse makes this unlikely. I am not aware of any cultures that still do this, but that doesn't mean it doesn't happen. Though Americans do something very similar when they get those helmets to make their children have perfectly round skulls. As for who had the deformation in every culture I am aware of that did this it was a sign of elite/special status. So the rich and the famous had their heads misshapen in stead of owning a lot of "bling".

    If you really want to see some really extreme cases of cradle boarding do a google image search for Paracas culture skulls. Crazy shaped skulls. Plus there are lots of trepanned skulls, but that's a whole different can of worms.
    "We're terrible animals. I think that the Earth's immune system is trying to get rid of us, as well it should." - Kurt Vonnegut

  5. #13
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by ktulu View Post
    The DNA testing is BS. PCR replication is not reliable on ancient skeletons. In fact it is fairly iffy on anything that is more than about 50 years old, and thats if it has received proper curatiation...
    As a geneticist I take exception to that comment. DNA testing is most certainly not BS. If properly executed it is a wealth of data. But the number of people who actually get it vs. the number of people who think they get it means that someone who is a slick talker can fleece those people in the latter group.

    And if they were doing PCR to "type" this thing then there is your problem. PCR can not "type" species. For that you need something like a SOLiD or an Illumina not to mention a reference sequence... All PCR does is amplify any given region of DNA...
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  6. #14

    Join Date
    Sep 2002
    Location
    Michigan
    Posts
    747
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I was not attacking DNA testing itself. I think the process itself is completely valid, I was saying their application of and interpretations of the testing was BS. I am sorry if you thought I was attacking DNA testing as a process, that was not my intent.

    As an archaeologists I am not aware of a single instance where DNA testing was reliably used to sequence ancient human DNA. They have done PCR on several occasions and every time the results either come back as no DNA present or there questionable techniques used and contamination is a real possibility.
    "We're terrible animals. I think that the Earth's immune system is trying to get rid of us, as well it should." - Kurt Vonnegut

  7. #15
    swords's Avatar
    Join Date
    Apr 2002
    Location
    Cernunnos Woods
    Posts
    8,120
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Though Americans do something very similar when they get those helmets to make their children have perfectly round skulls.
    Crazy, I didn't know anyone strapped anything to babies heads other than bonnets. lol!

    Treppanation is drilling the skull in early brain surgery right?

  8. #16
    rattler's Avatar
    Join Date
    Oct 2003
    Location
    missing, presumed dead
    Posts
    8,554
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by swords View Post
    C
    Treppanation is drilling the skull in early brain surgery right?

    yep........surprisingly though its popped up in cultures that should have very lil concept of something that complex.....also surprising the number of cultures its popped up in.....IIRC its even showed up on some neanderthal skulls
    cervid serial killer
    Know guns, know peace, know safety. No guns, no peace, no safety
    I didn't get stimulated but he kept his promise on change, that's about all I got left!
    http://www.wolfpointherald.com/--http://www.safety-brite.net/

Page 2 of 4 FirstFirst 1234 LastLast

Similar Threads

  1. Skull
    By TheAlphaWolf in forum General Discussions
    Replies: 53
    Last Post: 03-16-2005, 06:32 PM

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •