User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 3 of 4 FirstFirst 1234 LastLast
Results 17 to 24 of 26

Thread: The StarChild Skull

  1. #17
    Composter losfreddy's Avatar
    Join Date
    Sep 2003
    Location
    Katy,Tx
    Posts
    247
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quit reading my mind!

  2. #18

    Join Date
    Sep 2002
    Location
    Michigan
    Posts
    747
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    treppenation in the Andes is practiced quite early, quite extensively and had a very high survival rate about 2/3 would survive. They obviously were more intelligent than we like to think they were.

    As for the video freddy that is the same video where he says the same thing and honestly doenst make any sense.
    "We're terrible animals. I think that the Earth's immune system is trying to get rid of us, as well it should." - Kurt Vonnegut

  3. #19
    rattler's Avatar
    Join Date
    Oct 2003
    Location
    missing, presumed dead
    Posts
    8,554
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by ktulu View Post
    treppenation in the Andes is practiced quite early, quite extensively and had a very high survival rate about 2/3 would survive. They obviously were more intelligent than we like to think they were.
    thats kinda what i was getting at......alot of these "primitive peoples" sometimes had a quite good grasp on some rather complex subjects, they were a hell of alot smarter overall than most give them credit for.....that type of "brain surgery" being but one of them......
    cervid serial killer
    Know guns, know peace, know safety. No guns, no peace, no safety
    I didn't get stimulated but he kept his promise on change, that's about all I got left!
    http://www.wolfpointherald.com/--http://www.safety-brite.net/

  4. #20
    herenorthere's Avatar
    Join Date
    Feb 2003
    Location
    almost Hartford
    Posts
    3,785
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I once saw a documentary, maybe on PBS, about modern treppenation and the adherents described all kinds of mind-expanding benefits. A skeptic who was interviewed pointed out that pretty much all of them had been into hallucinogens and how that might have, um, colored their experiences and descriptions.

    I'd like to know how a society that molds skulls into special shapes is weirder than a society that encourages people to gorge on subsidized food, get the fat sucked out and the skin tucked and to then go through the whole process again.

    As for that whole primitive people thing, all of us would be in a whole lot of trouble if we ever had to build a car or antibiotic from scratch, while "primitive people" could do pretty much everything necessary for their lives. In fact, not only can I not make a Stanley hammer, I can't even make a stone hammer. A former friend of mine who's an archaeologist learned how to make stone tools and, if society collapses, I'm looking for him.
    Bruce in CT

    Madness is something rare in individuals but in groups, parties, peoples, ages it is the rule. Friedrich Nietzsche

  5. #21
    rattler's Avatar
    Join Date
    Oct 2003
    Location
    missing, presumed dead
    Posts
    8,554
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    i can do quite a bit of tool making if ive got access to scrap iron or steel.......if ive got to smelt my own steel im screwed though......antibiotics i cant do but have a half way working knowledge of basic medicinal plants.....asprin i can do......also pretty hard for me to starve even here in spring summer or fall......lots of edibles that dont taste half bad that most wont touch......or atleast wont think to.....

    cant make gasoline or diesel though and that can put a cramp on things...........but i can make alcohol so i wont have to care
    cervid serial killer
    Know guns, know peace, know safety. No guns, no peace, no safety
    I didn't get stimulated but he kept his promise on change, that's about all I got left!
    http://www.wolfpointherald.com/--http://www.safety-brite.net/

  6. #22
    herenorthere's Avatar
    Join Date
    Feb 2003
    Location
    almost Hartford
    Posts
    3,785
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I made leatherworking tools out of nails when I was a kid, but that depended on a supply of nails and on the tools I used to make them. With my geology background and an interest in early industrial processes, I think there's an outside chance that I could mimic CT's early charcoal iron industry, although I'd never be able to match the quality of its product. Of course I'd starve first because all the time spent trying to produce my first batch of iron would be time I didn't spend finding or producing food.
    Bruce in CT

    Madness is something rare in individuals but in groups, parties, peoples, ages it is the rule. Friedrich Nietzsche

  7. #23
    rattler's Avatar
    Join Date
    Oct 2003
    Location
    missing, presumed dead
    Posts
    8,554
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    im familiar with the process required for simple smelting but this part of Montana is relatively free of iron in smelting quantities.....it is present in the ground water as iron oxide but you would be hard pressed to get enough of it to make any tools, hence what i would able to do is dictated by what scrap iron i could find(and how much high quality charcoal i could produce).....rather than trying to extract raw iron oxide from the ground i would be better served looking for the many hundreds(thousands?) of scrap piles that litter the country side, every farm that survied atleast through the 50's had one......
    cervid serial killer
    Know guns, know peace, know safety. No guns, no peace, no safety
    I didn't get stimulated but he kept his promise on change, that's about all I got left!
    http://www.wolfpointherald.com/--http://www.safety-brite.net/

  8. #24
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by ktulu View Post
    I was not attacking DNA testing itself. I think the process itself is completely valid, I was saying their application of and interpretations of the testing was BS. I am sorry if you thought I was attacking DNA testing as a process, that was not my intent.
    Sorry for the misunderstanding, been in a few "fights" on other forums over DNA and was starting to feel like I was getting it everywhere. Reading back over your original post I see my mistake. Sorry.

    As an archaeologists I am not aware of a single instance where DNA testing was reliably used to sequence ancient human DNA. They have done PCR on several occasions and every time the results either come back as no DNA present or there questionable techniques used and contamination is a real possibility.
    Neandertals have been sequenced partially (60% IIRC) using next-gen techniques. And they have gotten the Neandertal mitochondria genome partially sequenced as well.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

Page 3 of 4 FirstFirst 1234 LastLast

Similar Threads

  1. Skull
    By TheAlphaWolf in forum General Discussions
    Replies: 53
    Last Post: 03-16-2005, 06:32 PM

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •