User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 4 of 4 FirstFirst 1234
Results 25 to 31 of 31

Thread: Snake i.d.?

  1. #25
    SirKristoff's Avatar
    Join Date
    Dec 2007
    Location
    Puyallup, WA United States
    Posts
    4,132
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by Ozzy View Post
    I'm leaning towards ratsnake too. Juvenile rat and racers looks so similar that I said it could be either one. It's not a corn snake because they are not in Ma.
    doesnt mean a couple werent released...look at the situation in southern florida with pythons lol. i know the climates and what not are waaay different. but its still theoretically possible.
    Yeah milk snake definitely fits better than rat still.

  2. #26
    Capslock's Avatar
    Join Date
    May 2003
    Location
    San Francisco, CA
    Posts
    3,088
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by swords View Post
    But why would any of them ever be inclined to do it if they never had a rattle?
    They rattle for the same reason that rattlesnakes evolved. The modern rattlesnake doesn't really "know" it has a rattle - it just instinctually twitches its tail. Before there was a rattle, it was still an audible and visual warning to predators. The appearance of the rattle improved the effect, and we got rattlesnakes. It probably began as a random mutation that caused a genetic propensity to twitch the tail, which in turn increased survivability.
    Malo Periculosam Libertatem Quam Quietum Servitium

    My photos are copyright-free and public domain

  3. #27
    swords's Avatar
    Join Date
    Apr 2002
    Location
    Cernunnos Woods
    Posts
    8,120
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    So the tail twitch came before the actual rattle... "velly intarrestink!"

    So anyway you didn't keep it? I've heard those are the "best starter snakes" from several shop keepers when I was taking my little cousin Julie around to look at reptiles. She eventually got a Veiled Chameleon from our cousin Katie who has a pair and he's grown huge and very pretty now but she didn't want a small milk snake or anything after seeing twin cities reptiles. She wanted the 9 foot python or the 4 ft baby american alligator - of course! "Can we please ask to use their phone and ask my mom if we can get the Alligator?"

  4. #28

    Join Date
    Oct 2002
    Location
    Lincoln, NE
    Posts
    2,974
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

  5. #29
    Your one and only pest! Ant's Avatar
    Join Date
    Dec 2006
    Location
    massachusetts
    Posts
    1,757
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by swords View Post
    So anyway you didn't keep it? I've heard those are the "best starter snakes" from several shop keepers when I was taking my little cousin Julie around to look at reptiles. She eventually got a Veiled Chameleon from our cousin Katie who has a pair and he's grown huge and very pretty now but she didn't want a small milk snake or anything after seeing twin cities reptiles. She wanted the 9 foot python or the 4 ft baby american alligator - of course! "Can we please ask to use their phone and ask my mom if we can get the Alligator?"
    I would NEVER keep a wild born snake, especially if I could get a captive breed one. Also my dad is very afraid of snakes and I don't feel like I NEED a pet snake. (he has asked me if I wanted one but I always said no to be nice.)

    I read online that eastern milk snakes generally have a Y or V shaped white spot on them. So I am starting to lean towards that one. (actually I have strong feeling it is the most likely one for my general location.)

  6. #30
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by SirKristoff View Post
    doesnt mean a couple werent released...look at the situation in southern florida with pythons lol. i know the climates and what not are waaay different. but its still theoretically possible.
    For the record. The Burmese pythons in S. FL were not pets that were intentionally released/escaped. They were animals that were unfortunately released when Hurricane Andrew laid waste to FL and destroyed a few reptile holding facilities in the process. Contrary to Senator Nelson's opinion the vast majority of reptile keepers are very responsible and do not just go out releasing random snakes for giggles
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  7. #31
    RL7836's Avatar
    Join Date
    Jan 2005
    Location
    New Jersey, USA
    Posts
    3,252
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Timely thread. Last week we had a young snake w/ similar appearance in the garage resting on a small ledge. I 'assumed' that it was a baby black rat snake since we had them (adults & babies) all over the place where I grew up in NE PA. However, looking at some of the pics, it looks like ours may also be a baby milk snake (have to empty the camera one of these days...).
    All the best,
    Ron
    You must do the thing you think you cannot do. --- Eleanor Roosevelt

    *** Growlist / Wants / Offers ***
    (with Pics)

Page 4 of 4 FirstFirst 1234

Similar Threads

  1. Snake I.D. please
    By DroseraBug in forum Reptiles, Amphibians and other terrarium dwelling animals
    Replies: 1
    Last Post: 03-25-2008, 07:44 PM
  2. 6ft rat snake
    By Ozzy in forum General Discussions
    Replies: 9
    Last Post: 05-14-2007, 11:01 PM
  3. SNAKE!!!
    By adnedarn in forum Reptiles, Amphibians and other terrarium dwelling animals
    Replies: 10
    Last Post: 03-14-2007, 06:57 PM
  4. My snake
    By JMurphy97 in forum Reptiles, Amphibians and other terrarium dwelling animals
    Replies: 4
    Last Post: 03-24-2006, 08:15 PM
  5. Snake pic
    By rattler in forum Reptiles, Amphibians and other terrarium dwelling animals
    Replies: 7
    Last Post: 06-16-2004, 08:24 PM

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •