User Tag List

Informational! Informational!:  0
Likes Likes:  0
Results 1 to 7 of 7

Thread: How to avoid an ebay scam

  1. #1
    Sarracenia Collector Adam's Avatar
    Join Date
    Jun 2008
    Location
    Pittsburgh, PA
    Posts
    1,946
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    How to avoid an ebay scam

    Leucophylla tarnock does not produce seed. If you see this seed for sale, it is a scam, or someone who has a leuco and thought it was a tarnock. glad i could help
    Growlist: http://www.terraforums.com/forums/sh...row-Trade-List
    Collection: http://www.terraforums.com/forums/sh...-Deadly-Plantsn
    Quote Originally Posted by lizasaur
    Minor x Purp I actually have. Well,technically it's Minor Okee x Psitt Green.

  2. #2
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Actually leuco Tarnok can produce seed. There is a thread on CPUK about this.

    There is also an unrelated sepaloid leuco that produces pollen and has been used by a few people to make some crosses.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  3. #3
    Two flies one pitcher. Minus the crap eating. obregon562's Avatar
    Join Date
    Aug 2007
    Location
    Lakewood, California, USA
    Posts
    1,253
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Pyro's right. It has functioning ovaries believe, but it cannot produce anthers/pollen. Using that unrelated messed up leuco Pyro mentioned, it is possible to make seed that should theoreticaly produce 'Tarnok' like plants.
    "It's easy to rip on cops, when you aren't the one needing saving"

    My Growlist

  4. #4
    Capensis's Avatar
    Join Date
    Mar 2008
    Location
    Everywhere. Capensis everywhere.
    Posts
    4,046
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Oh dang, I wish I knew that S. leuco 'Tarnok' could receive pollen before. :x
    http://www.terraforums.com/forums/image.php?type=sigpic&userid=6789&dateline=1352508752

  5. #5
    Sarracenia Collector Adam's Avatar
    Join Date
    Jun 2008
    Location
    Pittsburgh, PA
    Posts
    1,946
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Oh. i never knew that. If you cross a leuco with a tarnock, will it be a tarnock? possibly?
    Growlist: http://www.terraforums.com/forums/sh...row-Trade-List
    Collection: http://www.terraforums.com/forums/sh...-Deadly-Plantsn
    Quote Originally Posted by lizasaur
    Minor x Purp I actually have. Well,technically it's Minor Okee x Psitt Green.

  6. #6

    Join Date
    Jan 2009
    Posts
    1,672
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Wow cool! Thanks for the info Pyro, I did not know that about Tarnok.
    Is Tarnok sterile due to chromosome count or due to a chromosome abberation?
    If it's due to an uneven chromosome count I would be surprised if no one had tried to get some sort of allotetraploid clone from it to make it a non-sterile plant. It could make for some really impressive crosses I think.

  7. #7
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by awgaupp View Post
    Oh. i never knew that. If you cross a leuco with a tarnock, will it be a tarnock? possibly?
    Quote Originally Posted by obregon562 View Post
    Pyro's right. It has functioning ovaries believe, but it cannot produce anthers/pollen. Using that unrelated messed up leuco Pyro mentioned, it is possible to make seed that should theoreticaly produce 'Tarnok' like plants.
    Just to make a clarification here. We do not know that the sepaliod trait is necessarily a genetically proven trait. It is entirely possible (I would even say likely) that all offspring from Tarnok as a seed parent crossed with a normal Sarr or a normal Sarr crossed with the other sepaloid as a pollen parent will have normal flowers. If (and there is zero evidence of what I am about to suggest so it is all theoretical!!) the sepaloid trait is recessive then either of the above crosses would produce heterozygous plants that would then need to be back crossed to see if the sepaloid trait was indeed genetically inheritable.

    Frankie's example probably will not happen anytime soon. I only know of one group currently working with the pollen producing sepaloid (there may be others I do not know of) and they are under some bureaucratic rules so not able to distribute on any kind of large scale. Some of the pollen from that plant was passed to a few people so we will just have to see what the future brings from any seed produced by that pollen (assuming any was.)


    Quote Originally Posted by F R e N c H 3 z View Post
    Wow cool! Thanks for the info Pyro, I did not know that about Tarnok.
    Is Tarnok sterile due to chromosome count or due to a chromosome abberation?
    If it's due to an uneven chromosome count I would be surprised if no one had tried to get some sort of allotetraploid clone from it to make it a non-sterile plant. It could make for some really impressive crosses I think.
    No one knows what the cause of the sepaloid phenotype is. It has been documented in 3 species to date that I know of. All of these plants were found in field and not spontaneous seed grown mutants in cultivation.

    I am inclined to bet it is not a polyploidy matter as the fact that Tarnok has produced viable seed argues against polyploidy. Getting a polyploid to produce viable offspring when put against a normal ploidy is really really rare so I do not think we would see it right out of the gates like we did on this project.

    Right now we are too early on in the crossings to get a handle on what is going on. The plants that are now in their second year (IIRC) from Tarnok as a seed parent might just start flowering next year if we are lucky so maybe in another 2-4 years we will have an idea of if it is a heritable trait. And even then there is no guarantee as it may be a multi locus trait.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

Similar Threads

  1. Ebayer to avoid
    By Tony Paroubek in forum General Discussions
    Replies: 62
    Last Post: 04-28-2009, 04:36 AM
  2. Fyi scam warning: latest paypal imposter scam
    By D muscipula in forum General Discussions
    Replies: 17
    Last Post: 06-02-2005, 01:07 PM
  3. Ebay
    By Treaqum in forum General Discussions
    Replies: 11
    Last Post: 05-22-2005, 10:57 AM
  4. This is on ebay..
    By The Griffin in forum Tropical Pitcher Plants  (Nepenthes)
    Replies: 6
    Last Post: 04-13-2005, 09:52 PM
  5. Did i avoid a fire?
    By technoracer in forum General Discussions
    Replies: 0
    Last Post: 05-23-2004, 04:22 PM

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •