User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 3 123 LastLast
Results 1 to 8 of 19

Thread: Major coup for one of our own

  1. #1
    Av8tor1's Avatar
    Join Date
    Jan 2007
    Posts
    4,811
    Mentioned
    6 Post(s)
    Tagged
    0 Thread(s)

    Major coup for one of our own

    Congrats go to one of our own Kelly (ampac biotech) aka true424

    Ampac Biotech's strain of T. atroviride ("Plant Helper") kicked butt in a recent study when compared to other beneficials and trichoderma strains in the control of Phytophthora...

    woohooo, I knew you were good but dang girl, ask no questions and take no prisoners woman..

    Biocontrol Science and Technology
    Publication details, including instructions for authors and subscription information:
    http://www.informaworld.com/smpp/tit...ent=t713409232
    Evaluation of several commercial biocontrol products on European and
    North American populations of Phytophthora ramorum
    M. Elliott a; S. F. Shamoun b; G. Sumampong b; D. James c; S. Masri c; A. Varga c
    a Puyallup Research and Extension Center, Washington State University, Puyallup, WA, USA b
    Canadian Forest Service, Pacific Forestry Centre, Victoria, BC, Canada c Canadian Food Inspection
    Agency, Sidney Laboratory, Sidney, BC, Canada
    First published on: 15 October 2009

    Results
    "Inhibition of Phytophthora ramorum growth in vitro
    There was no significant difference in percent inhibition of P. ramorum growth on
    agar plates between products containing B. subtilis (Serenade† and Companion†)
    (Table 3). Clonal lineages of P. ramorum differed in their response, with NA1 being
    more inhibited than NA2 and EU1 (PB0.01). There was no difference among
    lineages in percent inhibition by Actinovate† (P0.71). Actinovate† performed the
    worst of the three bacterial BCAs in vitro, with about 30% inhibition of all
    P. ramorum genotypes. In tests involving Trichoderma spp., Plant Helper†
    (T. atroviride) provided 100% inhibition of all genotypes
    , while T. virens, the
    Trichoderma species in SoilGardTM, was more variable and ranged between 9 and
    58% inhibition among the three lineages (Table 3)...."


    one other interesting tidbit, it mentions that B. subtilis decreases the beneficial effects of Trichoderma if i read it correctly. So it may not a good idea to buy those "soup mix" products that contain a little bit of everything

    You go girl!!!!
    Av

  2. #2
    true424's Avatar
    Join Date
    Jan 2009
    Posts
    37
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Thanks Av,
    We were pretty pleased with the results.
    Kelly

  3. #3
    Carnivorous plant enthusiast vraev's Avatar
    Join Date
    Aug 2006
    Location
    Ontario, Canada
    Posts
    2,806
    Mentioned
    1 Post(s)
    Tagged
    0 Thread(s)
    yay for Kelly!! Glad to see your hard work being scientifically justified.

  4. #4
    Frilleon's Avatar
    Join Date
    Dec 2008
    Location
    Sonoma County CA
    Posts
    643
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Very nice! I'm looking into getting me some of this!
    Grow List: http://www.terraforums.com/forums/sh...d.php?t=116427
    Member of BACPS & ICPS

    A question that sometimes drives me hazy: am I or are the others crazy? Albert Einstein

  5. #5
    Lucky Greenhorn Lil Stinkpot's Avatar
    Join Date
    Oct 2009
    Location
    San Jose, CA
    Posts
    2,075
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Forgive a noobish question, but what are we talking about?
    If you shake a rain stick, you get rain. I need a hamata stick.
    My WWWs

  6. #6
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    AH HA!!! Now I know why "Ampac Biotech" was so familiar when Av mentioned it, you are the Tricho guys he uses!!

    Congrats Kelly

    (p.s. The Sarrs love Tricho )


    Quote Originally Posted by Av8tor1 View Post
    one other interesting tidbit, it mentions that B. subtilis decreases the beneficial effects of Trichoderma if i read it correctly
    If I had access to the strains they are using and a PCR machine I bet I could tell you why. And if my hypothesis is correct not all strains of B. subi. will act this way. Course finding a commonly available atypic lineage commercially is probably a feat...
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  7. #7
    SirKristoff's Avatar
    Join Date
    Dec 2007
    Location
    Puyallup, WA United States
    Posts
    4,132
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    woooo puyallup was actually named in something...XD

  8. #8
    Av8tor1's Avatar
    Join Date
    Jan 2007
    Posts
    4,811
    Mentioned
    6 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by Lil Stinkpot View Post
    Forgive a noobish question, but what are we talking about?
    Stinkpot, Trichoderma is a beneficial fungi that forms a symbiotic relationship with plants. It will attack/antagonize other phytopathogens and increase plant growth.

    Here is a good research paper on the subject (notice the electron microscope images)
    http://bluegrasscarnivores.com/resea...a_research.pdf

    One caveat.... some say its worthless, others swear by it... read the research and decide for yourself

    HTH's
    Av

Page 1 of 3 123 LastLast

Similar Threads

  1. update from wes major
    By vraev in forum General Discussions
    Replies: 2
    Last Post: 11-09-2006, 10:24 PM
  2. Major Lurker
    By hexen84 in forum Introduce Yourself!
    Replies: 7
    Last Post: 06-13-2006, 12:25 PM
  3. Major u. subulata purge!
    By jimscott in forum Utricularia, Aldrovanda, Genlisea
    Replies: 5
    Last Post: 08-28-2005, 05:18 PM
  4. Major questions here!
    By ccrider1016 in forum General Discussions
    Replies: 3
    Last Post: 11-18-2002, 09:17 AM
  5. There is a major web forming
    By Meagan in forum Venus Flytrap (Dionaea ) Care Information & Tips
    Replies: 9
    Last Post: 07-18-2002, 01:11 PM

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •