User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 5 of 10 FirstFirst 123456789 ... LastLast
Results 33 to 40 of 76

Thread: Just to clear some things out for he newbies

  1. #33
    rattler's Avatar
    Join Date
    Oct 2003
    Location
    missing, presumed dead
    Posts
    8,554
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by GrowinOld View Post
    Don't get "Rattled"!
    Its a kid!

    Wake up people! Just let the thread die!

    Makes me wish there were a separate place for this sort of thing.
    It really lessens the integrity of the forum, for members who are serious about the hobby.
    it boils down to other newbies will take it seriously and stupid and worthless info keeps getting passed around......kinda like the morons that keep saying hamata is an ultra-highlander though it aint and they have never even grown it but they insist on passing on info like they have been growing the species for years......bad info doesnt do the hobby any good....especially kids just getting started in it.....
    cervid serial killer
    Know guns, know peace, know safety. No guns, no peace, no safety
    I didn't get stimulated but he kept his promise on change, that's about all I got left!
    http://www.wolfpointherald.com/--http://www.safety-brite.net/

  2. #34
    Not Growing Up! GrowinOld's Avatar
    Join Date
    Jun 2008
    Location
    ARTificial Bog in da' Middle of da' USA
    Posts
    932
    Mentioned
    1 Post(s)
    Tagged
    0 Thread(s)
    Amen!
    Experience is the best teacher. At least it used to be.
    But then, common sense isn't so common anymore, is it.


    http://www.terraforums.com/forums/sh...d.php?t=113866

  3. #35
    Your one and only pest! Ant's Avatar
    Join Date
    Dec 2006
    Location
    massachusetts
    Posts
    1,757
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by scottychaos View Post
    IF these plants were NEVER allowed to cross with other VFT's, or if they were never allowed to flower or reproduce by any means other than vegetative reproduction..then you would be correct..
    but we all know that is not the case..
    therefore you are wrong..
    they do "weaken the species" because the genes of the "deformed" varieties are continually mixed with other VFT genes, because people want to create even more "wacky" deformaties..
    therefore I am right..these varieties weaken the species overall..because "un-natural" genes (gene combinations that would not exist without human intervention) are created and allowed to propagate..

    I have nothing to reword!

    Thats a brilliant idea!
    I love it..

    the plants are taking advantage of the stupidity of humans to pass on their genes!
    hmmm..there might be something to that!

    Scot
    You can determine if a plant is weak simply by looking at it? Its a pretty big assumption that because some varieties have different traits (that clearly do no prevent it from eating insects like the crazy pom pom thing) that they would weaken a species in the wild. First of all, unless you live in the native range of the vft or are growing seeds that are intended to be used to return them to the wild locations that are of NO DANGER TO ANYTHING IN THE WILD. Experienced growers who intend to keep species location plants for release later on would never cross them with another clone or even location. Also, if it would simply never exist in nature like you stated, then it goes against your point! If it escaped into a wild bog and would be weaker then the rest it would die off! Now I would understand if you don't want to have impure genes in your plants because they are weak (making the less attractive to the eye or harder to grow) but, that is no reason to kill off mutations others find attractive. You have simply a differing taste in what makes something look good that I tend to agree with, just don't try and push it down others' throats.

    Quote Originally Posted by amphirion View Post
    is it really selective pressure that brought these plants into cultivation in the first place? i thought most of the deformed trap cultivators arose out of TC errors during cultivation. they're accidents--but no....somebody had to turn them into novelties and replicate them. so naturally (in the litteral sense, in their native habitat) you would never find deformed, mutated runts in the wild. however, i'd think it'd be cool to have a flytrap that produced 2 traps per petiole consistently.
    I am pretty sure there has never been a proven case where a vft has been mutated by TC. If seeds are started in tc like they do with new Nepenthes added to cultivation it could give the appearance that they are mutated by it even though they aren't. Go ahead and prove me wrong though, I would really like to see a mutation caused in a plant by TC.

    Edit: I was proved wrong. Never knew it was proven. Any one know what mutagens cause these? Here were the examples used, stated to be tc mutants in the description.
    http://cpphotofinder.com/dionaea-wacky-traps-367.html
    http://cpphotofinder.com/dionaea-fused-tooth-439.html

  4. #36
    i dont do pots. amphirion's Avatar
    Join Date
    Oct 2009
    Location
    SF Bay Area, US
    Posts
    3,498
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    well ant if you think about it, while in the growth medium, the cells of the plant are multiplying at an exponential rate. DNA code is being replicated over and over and over in rapid fashion for countless numbers of times as the tissue develops into a callous. at that rate, it is very easy for DNA to misreplicate a couple of base pairs or to add in new base pairs in the process (if you know about genetics, you'll understand why this is a big deal). normally, the cell has ways of repairing the strands, but since the rate of division is so high, the cells divide before the 'proof reading' enzymes get to fix the DNA.
    " You keep using that word. I do not think it means what you think it means." -Inigo Montoya
    +growlist
    +petiolaris drosera going dormant?
    +picture thread

  5. #37
    Doing it wrong until I do it right. xvart's Avatar
    Join Date
    Aug 2006
    Location
    Zone 8
    Posts
    5,594
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by Timmy View Post
    Moof on flytrapcare, his Sawtooth has never flowered.
    I'm surprised that nobody has mentioned that maybe it hasn't flowered because it has a standard photoperiod that doesn't change year round?

    Quote Originally Posted by SirKristoff View Post
    lol Scot....they weaken the species? sure they are ugly and i dont care for them either
    but they dont weaken the species lmao
    they are weak to their own little cultivar, not the entire freaking species...
    I am on Scot's side here. I am no expert on whether or not "cup traps" are genetically weaker; but if they are then breeding them in cultivation is making a population of weaker Dionaea. As long as plants bred with genetically mutated are being passed around then the genes are too. You could get plants that are D. genetically strong x D. genetic mutant and have a plant that appears like a standard Dionaea but still have the gentics to pass on in F1 or F2's.

    I agree that mutants should be burned on site. I would be super angry if I got a plant with mutant genes in it and didn't learn about it until I crossed it and all the children were freakazoid weaklings. I wouldn't even want a seeds from a plant in a greenhouse with a mutant, unless I was assured beyond a reasonable doubt that the mutant had never flowered.

    Obviously, the example above is exaggerated; but the outcome is the same.

    xvart.
    "The tragedy of life is not that every man loses; but that he almost wins."

    "Quis custodiet ipsos custodes?"

  6. #38
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Oh boy genetics.... Now I know that tune, who wants to dance??

    Quote Originally Posted by scottychaos View Post
    genetics "wants" to improve the species..not weaken it..
    To be clear here we are talking about genes and not genetics. Genes, in and of themselves, do not "want" anything. A gene is nothing more than a unit of information, it has no "wants" or "goals".

    many "bad" mutations survive because of humans, when they *shouldnt* and wouldnt survive if nature was left to its own devices..
    A mutation is no more "bad" than it is "good". A mutation simply is. However, how that mutation effects the organism can be said to be "bad" or "good" but that is totally arbitrary depending on who/what is making that determination. For example, most everyone would agree that Sickle Cell Anemia is "bad" and yet, in parts of the world where malaria is rampant, being a carrier for the Sickle Cell gene gives you a resistance to malaria which most people would say is "good". So, is Sickle Cell "bad" or is it "good"?

    Personally I cant stand the "bart simpson" type VFT mutations..I think they are an abomination and should all be destroyed (seriously..not joking) because they weaken the species..(and dont even get me started on Persian cats, Pug dogs, and parrot cichlids..ugh..)
    You cannot say that they weaken the species, I am sorry Scot. You are putting a trait on genes that simply is not there, basically you are personifying them. I am tired of the "good"/"bad" label because it simply is not applicable so let me use what geneticists use: "Fit", which brings us also to one of the single most misunderstood ideas in genetics/evolution, the idea of "Fitness".

    A gene is "fit" only in relation to other variants (alleles) of that same gene it has nothing to do with the organism as a whole or how that gene relates to other genes.

    So, genetically speaking, Wacky Traps (aka Bart Simpson) and Pugs and Persians and Parrot cichlids are all very much genetically fit because the genes for those traits have survived the process of selection. I grant you that that selection was at the hand of "man" and not "nature" but that simply does not matter.

    The species in and of itself is not weak. There are numerous other alleles of those genes out there and if the selective pressure switches then the unfit genes will be culled from the population and new ones will take their place.

    and lots of other things that "genetics wanted that way" arent good either..
    cancer, being born without arms or legs, downs syndrome..the list goes on an on..
    just because its "caused by nature" doesnt necessarily mean its "the best of what nature intends"!
    Again, genes do not want, they simply are. You must quit personifying them.

    And for the record, cancer is actually the ultimate in fitness from a genetic stand point. Immortality is the ultimate in "self-preservation".

    Quote Originally Posted by scottychaos View Post
    IF these plants were NEVER allowed to cross with other VFT's, or if they were never allowed to flower or reproduce by any means other than vegetative reproduction..then you would be correct..
    but we all know that is not the case..
    therefore you are wrong..
    they do "weaken the species" because the genes of the "deformed" varieties are continually mixed with other VFT genes, because people want to create even more "wacky" deformaties..
    therefore I am right..these varieties weaken the species overall..because "un-natural" genes (gene combinations that would not exist without human intervention) are created and allowed to propagate..
    Just because a mutant gene is present in a pool does not by default mean that pol is weakened. Again I point you back to the Sickle Cell gene, outside of malaria regions it is not a fit gene but within those malaria areas it is most certainly a fit gene, and purging it from those populations would actually hurt them. I can think of many other cases where the presence of a mutant gene actually ended up conferring a fitness unto a population by its presence.

    So, you cannot correctly say that mutant individuals will, by default, harm the population.

    Quote Originally Posted by xvart View Post
    I am on Scot's side here. I am no expert on whether or not "cup traps" are genetically weaker; but if they are then breeding them in cultivation is making a population of weaker Dionaea. As long as plants bred with genetically mutated are being passed around then the genes are too. You could get plants that are D. genetically strong x D. genetic mutant and have a plant that appears like a standard Dionaea but still have the gentics to pass on in F1 or F2's.
    That argument does not stand up to reason though. There are perfectly normal looking plants from perfectly normal looking parents that are in no way genetically related to "cup traps" and yet harbor "weakness" genes and could produce weak offspring. Whether a plant grows weakly is likely not the result of a single gene. Every year people are producing plants from crosses where they sow the seed out and a few years later the weak plants have died or been pulled but the strong plants are sent out to others likely carrying some of those same genes that made their siblings weak. And yet no one baulks about that.

    I agree that mutants should be burned on site. I would be super angry if I got a plant with mutant genes in it and didn't learn about it until I crossed it and all the children were freakazoid weaklings. I wouldn't even want a seeds from a plant in a greenhouse with a mutant, unless I was assured beyond a reasonable doubt that the mutant had never flowered.

    Obviously, the example above is exaggerated; but the outcome is the same.
    The example hits a flaw though. While you may not like those genes popping up in your collection some one else may. I can relate this back to a snake breeder who bred a couple snakes together looking for one result (piebald) and got out another (piebald, axanthic and piebald axanthic). He was not aware that either snake carried the axanthic gene but he was thrilled to discover they did.


    When we are dealing with such things as "desirable" mutations there is always a level of subjectivity on what exactly is desirable. You do not like cup trap and I do. I do not like fused tooth and you do. So what happes is that I do not breed fused tooth plants and you do not breed cup traps and some people will want my plants and some people will want your traps and then one day someone who wants a fused tooth cup trap will get both of our plants and breed them together and get something new and unusual that will rock the VFT community. So while we each have our dislikes the genes behind those dislikes still have their fitness under the selective pressure of the collector. No "good". No "bad".
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  7. #39
    BANNED
    Join Date
    Mar 2010
    Posts
    230
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Thanks, for posting that

  8. #40
    Not Growing Up! GrowinOld's Avatar
    Join Date
    Jun 2008
    Location
    ARTificial Bog in da' Middle of da' USA
    Posts
    932
    Mentioned
    1 Post(s)
    Tagged
    0 Thread(s)
    Nice Dancin" there!
    Experience is the best teacher. At least it used to be.
    But then, common sense isn't so common anymore, is it.


    http://www.terraforums.com/forums/sh...d.php?t=113866

Page 5 of 10 FirstFirst 123456789 ... LastLast

Similar Threads

  1. my fellow newbies...
    By Presto in forum Venus Flytrap (Dionaea ) Care Information & Tips
    Replies: 10
    Last Post: 06-12-2006, 08:07 AM
  2. for newbies
    By Copper in forum Carnivorous Plant Trading Post
    Replies: 7
    Last Post: 03-07-2006, 07:03 PM
  3. my fellow newbies..
    By Presto in forum Venus Flytrap (Dionaea ) Care Information & Tips
    Replies: 18
    Last Post: 03-04-2006, 12:01 PM
  4. Cps for newbies
    By Amateur_Expert in forum Carnivorous Plant Trading Post
    Replies: 2
    Last Post: 11-11-2004, 12:29 PM
  5. Seed packet folding for newbies
    By wickedthistle in forum General Discussions
    Replies: 1
    Last Post: 07-01-2004, 10:30 PM

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •