User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 7 of 10 FirstFirst ... 345678910 LastLast
Results 49 to 56 of 76

Thread: Just to clear some things out for he newbies

  1. #49
    scottychaos's Avatar
    Join Date
    Aug 2001
    Location
    Western New York, USA
    Posts
    2,970
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by Est View Post
    I do believe that the point was that they are not weak because it's people making the selection, not nature. They may be less healthy, but so long as people select for those traits, the genes are more fit.
    hmmm..interesting concept..
    (I had forgotten that concept was brought up a few days ago! and that I agreed with it on a basic level..which I do.)
    so the deformity is considered a benefit, because its what the humans select for, thus what I consider a weakness is actually a strength for that variety..
    ok..thats basically logical..
    but it still makes the organism weaker when compared to its natural form..

    Pug traits survive because humans have selected them..
    therefore Pugs are "fit" for basic survival..
    but its still a very weak, sickly animal in reality..even though it does technically survive through human intervention..

    I see your point..but I still cant accept that these characteristics are actually strengths in reality, because to the organisms themselves, they are real drawbacks..even if they do allow them to actually exist in the first place..

    yes, Persian cats would not even exist, at all, if they hadn't been created artificially..
    but IMO, they shouldn't exist..I consider it cruel to deliberately create animals with deliberate deformities that cause them to have health problems.


    I'm sure Travis can better elucidate than I, but here goes. Cancer shuts down apoptotic pathways -- that is, it prevents cells from "killing" itself because it is damaged. Normally, when a cell ceases to function correctly, apoptosis (programmed cell dead, as it's often referred to) is used to cull the cell. Furthermore, there are lines of cancerous cells which have been used in lab and successfully reproduced for the past 50 or 60 years (search HeLa for more).

    .
    ok fine..again that makes sense from a viewpoint of basic logic..
    sure, to cancer cells, cancer is wonderful thing..
    sure, cells dont die because of cancer..ok fine.

    It might be "good" for those individual cells..in the short term..
    but human cancer cells cant exist outside of their "host"..which they will eventually kill..

    Try telling the person actually dying of cancer that "cancer is actually the ultimate in fitness from a genetic stand point."..
    see if that cheers them up any..


    Scot

  2. #50
    War. War never changes. Est's Avatar
    Join Date
    Apr 2004
    Location
    Champaign, IL
    Posts
    3,935
    Mentioned
    3 Post(s)
    Tagged
    1 Thread(s)
    Try telling the person actually dying of cancer that "cancer is actually the ultimate in fitness from a genetic stand point."..see if that cheers them up any..
    Nobody said it would or should. You asked how cancer cells are immortal -- I told you. Travis mentioned it in passing as a sidenote. It's noteworthy because "genetic fitness" is not always what we think of as good. As is the case with these "designer animals".

    but IMO, they shouldn't exist..I consider it cruel to deliberately create animals with deliberate deformities..
    That's fine, that's your opinion and you're fully entitled to it. However, you can't logically argue that they're less genetically fit for this environment (in which human selection is such a significant pressure).

    Aaaand with that it was all resolved. :P
    ¯\(º_o)/¯ ಠ_ಠ
    My Growlist
    NASC Website Come join in on the fun!

  3. #51
    Hello, I must be going... Not a Number's Avatar
    Join Date
    Nov 2006
    Location
    Los Angeles, CA
    Posts
    7,506
    Mentioned
    5 Post(s)
    Tagged
    0 Thread(s)
    Re: 'Cupped Trap'

    I've been growing this clone for nearly 3.5 years and don't find it any more vigorous than any of the dozens of "typicals" I have. Indeed I find that many of it's annoying habits make it less likely to thrive than your average typical (how's that for redundancy). I've had maybe five or six die on me since I found the one I started out with in a local Home Depot. Fortunately the first thing I did was cut the flower stalk on it and send it to a friend to propagate in tissue culture. Thus I had backups available.

    The Good:

    The first year out of tissue culture it grows splendidly (but what flytraps doesn't).
    I find it to be an attractive looking mutation. Yes, the traps are fully functional and are capable of catching prey on their own. The traps are sometimes slower to close than "normal" form traps but they still catch prey.
    Under lights or very strong sunlight they color up nicely, but then again so do many flytraps.

    The Bad:
    They flower constantly whether you clip the flowers early or not. 8 flower stalks over the entire growing period is the record for me so far.
    Worse than that this plant has a tendency to divide when they flower. While you may think this is a good thing the result is that the rosettes never get much bigger than two or three inches across. And the survival rate of the divisions are poor.
    Also the flower stalks are relatively thin. You are more likely to get strikes from thicker flower stalk cutting for obvious reasons.
    They go through trapless phases. Either tiny traps or just a "tendril" or nub instead of a trap. Usually this happens for the first month or two after coming out of dormancy or while flowering (clipped or not) but can happen at any time. I've had two plants in the same pot (flower self-divisions from the previous year) one without traps the entire growing season
    Grand Hotel... always the same. People come, people go. Nothing ever happens.

  4. #52
    War. War never changes. Est's Avatar
    Join Date
    Apr 2004
    Location
    Champaign, IL
    Posts
    3,935
    Mentioned
    3 Post(s)
    Tagged
    1 Thread(s)
    Next person to post a picture because "lol this thred is dum" is gonna get smacked. I'm tired of a thread getting a little dicey and then dragged past the point of return by people posting a funny picture. It just leads to more pictures, more useless posts, and doesn't contribute to the thread.

    If you think a thread is dumb, don't participate. If you think there is something inappropriate going on in a thread, report it. If you have something useful to say, by all means contribute.

    And if a thread is supposed to be dumb, by all means, post funny pictures all day. Facepalms (etc, etc, etc) are not particularly informative, however.
    ¯\(º_o)/¯ ಠ_ಠ
    My Growlist
    NASC Website Come join in on the fun!

  5. #53
    scottychaos's Avatar
    Join Date
    Aug 2001
    Location
    Western New York, USA
    Posts
    2,970
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by Est View Post
    However, you can't logically argue that they're less genetically fit for this environment (in which human selection is such a significant pressure).
    well..yes they are less genetically fit for this environment..
    just because they are less genetically fit, period.

    Aaaand with that it was all resolved. :P
    pretty much yes..

    Scot

  6. #54
    allegedhuman's Avatar
    Join Date
    Jan 2008
    Location
    Michigan
    Posts
    307
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by scottychaos View Post

    tell me how a Pug dog or a Persian cat or a Bart Simpson VFT is MORE fit (or even equally fit) than a "typical" variety, and maybe I will believe you..but you cant do that..because its simply not true..because they are most definitely less fit..bred to be less fit purposely by humans..only for the novelty, or for making money..how can that be considered a good thing?

    Scot

    When talking about fitness here it should be the biological context of fitness but I am mentioning this point in case some people may be using the common use of fitness to describe physical condition. Biological/genetic fitness of an individual refers to an organisms ability to reproduce and pass on its genes. Basically fitness boils down to how many offspring you leave behind. NOT how physically fit you are or how hardy and vigorously a plant grows, etc.

    I doubt the average show cat, squished-nosed, pedigreed Persian cat would last long having to hunt down meals in the wild compared to a normal cat. Dump both cats off in the wild and in that case your average cat would likely have the higher fitness because it would survive longer and be able to have more litters than the Persian. But compare the same two cats in a domestic situation and chances are the pedigree show cat will be in demand as a sire due to its pedigree and breed while the only action the standard cat would have is what it could sneak on its own, if it wasn't neutered first. Compare that to the persian with a waiting list for breeding opportunities the persian's fitness would be higher.

    There is no one absolute fitness that is THE best. Fitness does matter on the environment. One organism may have a particular set of genes which gives it superior fitness in one environment, say for a plant a wetter one, where it has many offspring but move that same individual to a new environment which is dryer it is less fit if it does not reproduce as well compared to others individuals which have sets of genes which allow them to reproduce better in a dry environment compared to a wet one (and vice versa).

    Not sure if this was a confusion for anyone reading but figured if it was it would clarify what the term fitness is..or should...be referring to.

    Just because that giant steroid pumped muscle-bound guy at the gym might be physically fit (albeit gross looking)...well steroids are not necessarily the best thing for his reproductive fitness due to some..undesirable... side effects

  7. #55
    Not Growing Up! GrowinOld's Avatar
    Join Date
    Jun 2008
    Location
    ARTificial Bog in da' Middle of da' USA
    Posts
    932
    Mentioned
    1 Post(s)
    Tagged
    0 Thread(s)
    Well said.
    How often we forget that we are a part of the system also.
    If a plant were mutated, and began a new strain growing with little or no defenses and highly susceptible to diseases, highly desired as a delectable food-source for animals and bugs, and perhaps even if it were very fragile and difficult to grow, (growing only on the mountain peaks of some tropical forest perhaps or some such rare/extreme environment) ...it might not be a "BAD" mutation!

    In this day and age, it would only have to have leaves of sterling silver, flowers of solid gold, roots that would kill/cure cancer in humans, and a perfumed scent that made one feel intoxicating pleasure or relief from pain, and believe me, even with its "bad" traits, it would certainly grow and thrive miraculously!

    It would do this WITHOUT building up resistance to disease, animals or bugs! Because it would offer US so much that WE desire, we would make sure it survived and would attempt to grow it and perpetuate its species (and possibly keep it from others, make it illegal, or who knows what else!)!

    Point being, WE also can help determine if a plant is to live or die too! Like the Bart Simpson VFT's, they propagate and multiply and live on, simply by the people who like it, want it and grow it! How many plants and animals died off in extinction because of US! If we don't value it, we often let it die, or destroy its environment. If however we do value a plant, we take steps to preserve and protect it! In essence, if you could get high or cure cancer with Bart Simpson VFT's, people's opinions of it would change miraculously!

    WE have altered the environment so much on this planet, that the normal "natural" rules and environments are not the only ones to consider any more! (As was mentioned, as far as preserving a variety of plant or animal and perpetuating the species, sometimes we pick a "weaker", less healthy individual and desire it more because of its other characteristics that strike our fancy, than the healthy but less "attractive" one!) Humans do not always base their "desires" on the most logical premises. Indeed, "novelty" and "money making" have become a part of our environment, as well as the environments of everything else on this planet! (Duh, where have you been if you don't realize this!)

    Truly, we do not realize how important WE are in this process now, as well as how important our decisions and actions are, on this planet!
    Experience is the best teacher. At least it used to be.
    But then, common sense isn't so common anymore, is it.


    http://www.terraforums.com/forums/sh...d.php?t=113866

  8. #56
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Est and Rattler hit most of the points on this but I wanted to just touch back on some of it as well

    Quote Originally Posted by scottychaos View Post
    you are wrong about pugs and persians and parrot cichlids..
    No, I do not believe I am.

    they really are remarkably "weak" simply because they have bred to be "cute"..
    Persian cats and pug dogs have been bred to have flattened, smooshed faces, so they look more human and "cute"..this results in breathing problems, asthma, and shortened life.
    these are very inferior animals, compared to the ideal of the species..
    Physically, I agree. they are weaker animals than, say, a German Shepherd. But we are not talking about physical fitness, we are talking about genetic fitness.

    As I noted, this idea was touched on by a few others but really quickly:

    These subsets of a population (note, it is not the whole population that we are dealign with in these situations) are genetically fit because the traits (i.e. phenotype) conferred by the genes is desirable (to some, not necessarily to you) and therefore the genes are under positive selective pressure to maintain their presence in the selected pool. So these animals are genetically fit.

    they would never survive in nature..
    But we are not talking about "in nature". I never once said "natural selection" I said "selective pressure". Breeding for certain breed traits is a selective pressure (hence the term "selective breeding") it has nothing to do with nature but the end result is much the same: Traits that are fit (genetically fit, not physically fit) are the ones that survive.

    they are inferior animals, bred, on purpose, by humans, to be deliberately deformed
    Yes, exactly. And those deliberate deformities are genetically based so those genes are fit under the selective pressure they have been subject to

    ..which causes the animals to have medical problems..
    Irrelevant to the argument of whether they are genetically fit.

    how is that not "weakness"? then when people breed these poor animals with other breeds, it introduces these genes into the larger gene pool of the entire species..
    Yes, outbreeding introduces the genes to a larger pool (not the entire pool though, unless you breed them to every other breed out there which cannot happen for more reasons I care to go into at this moment.) Even then it does not "weaken" the pool. Yes the genes are present but, if they are selected against then their fitness drops and they are purged and if they are selected for then they remain fit and remain in the pool.

    If humans ceased to exist, eventually these traits would be culled out..which would be a good thing..but as long as humans exist these "weak" animals will be allowed to exist, and suffer..
    Yes, because the selective pressure would change. They genes would lose their fitness. But that does not change the fact that in the here and now, those genes are absolutely fit.

    Can Bart Simpson VFT's actually catch bugs? if they cant, thats a weakness and a disadvantage for that plant..when those plants are bred with "normal" VFT's, the genes are allowed to enter the main gene pool..
    IF the plant were in the wild it would be at a selective disadvantage I agree. But we are not talking about a plant in the wild. How many carnivorous plants in cultivation have to rely on their ability to trap bugs? It is irrelevant in cultivation how good or bad it can trap bugs because in cultivation LOOKS are king and Bart Simpson is wonderfully fit

    I dont understand what you mean by that..how is cancer immortal?
    Quote Originally Posted by Est View Post
    I'm sure Travis can better elucidate than I, but here goes. Cancer shuts down apoptotic pathways -- that is, it prevents cells from "killing" itself because it is damaged. Normally, when a cell ceases to function correctly, apoptosis (programmed cell dead, as it's often referred to) is used to cull the cell. Furthermore, there are lines of cancerous cells which have been used in lab and successfully reproduced for the past 50 or 60 years (search HeLa for more).

    Other mechanisms are induced that prevent cells from senescing (eg, search telomerase). These cells can reproduce and continue to function as cancer cells indefinitely.
    More or less the nail on the head Est.

    ok fine..again that makes sense from a viewpoint of basic logic..
    sure, to cancer cells, cancer is wonderful thing..
    sure, cells dont die because of cancer..ok fine.

    It might be "good" for those individual cells..in the short term..
    but human cancer cells cant exist outside of their "host"..which they will eventually kill..
    Not all cancers kill. And as Est noted:

    Quote Originally Posted by Est View Post
    You asked how cancer cells are immortal -- I told you. Travis mentioned it in passing as a sidenote. It's noteworthy because "genetic fitness" is not always what we think of as good.
    Cancer is a very noteworthy example of how something we consider very bad has a very high genetic fitness.

    Try telling the person actually dying of cancer that "cancer is actually the ultimate in fitness from a genetic stand point."..
    see if that cheers them up any..
    Scot, that is a rather low blow.

    I am not some heartless cruel ******* who gets a kick out of wantonly hurting people. I would never make such a comment to a person with cancer.

    We were (I thought) having an intellectual discussion and I answered in an intellectual sense, something that is scientifically interesting and noteworthy. I do not appreciate you twisting it into such a callus emotionally charged one and implying that that was my intent.

    yes I can say that..the entire population of Persian cats is very much harmed..
    they cant breath properly, they often have asthma, all in the name of smooshed "cute" faces..of course that is deliberate harm..how can it not be harm?

    and if those genes get into the general cat population, you end up with cats with characteristics that have the potential to cause harm..weakened cats..which would not happen naturally..

    I dont see how it cant be conisdered harm, or weakness..
    You are talking about the ideas of physical fitness and genetic fitness as if they were the same thing when they are not.

    Persian cats are not harmed, genetically, because the genes for the phenotype are maintained in spite of the fact that they are physically deformed. Breed selection maintains the genes. The genes are fit. The Persian cat population is not harmed because the genes are maintained. To remove the genes that cause the phenotype would harm the population because it would result in the breed no longer existing.

    If the genes "escape" the breed pool then so what. Selective pressure will work on them as it will work on them. If they end up in a pool where they are unfit then they will be eliminated. If they end up in a pool where they are fit then they will be maintained.

    tell me how a Pug dog or a Persian cat or a Bart Simpson VFT is MORE fit (or even equally fit) than a "typical" variety, and maybe I will believe you..but you cant do that.
    I most certainly can do that. That they exist and perpetuate proves they are fit. Just because you do not like them does not mean everyone does not like them. Put a typical VFT and a Bart Simpson down in front of a newbie and tell him he can have either one of them for free and I would bet that probably greater than 50% of the time the newbie would take the Bart Simpson. That is selective pressure. That is fitness. Remember that we are talking about a morph in a hobby where morphs have value, no matter how physically screwed the morph may be. Because the morph has value it is more fit than the typical.

    As another example let me hit my other hobby: snakes. One of the most popular snakes for people is the ball python which has over 60 base mutations (i.e. morphs). On any given weekend I could go to a reptile show and buy a normal ball python for $10. But if I want a morph the price immediately goes up by an order of magnitude and that is for the morphs that hardly look different from the normal ball pythons. Get to something that looks really different and the price tag goes up even more.

    The fact that morphs are different gives them value (no matter how right or wrong you personally feel on the matter). That they have value means there is a selective pressure on morphs. That selective pressure results in them becoming more fit under cultivation regardless of how fit they may or may not be in the wild or how physically well off they may or may not be.

    because its simply not true..because they are most definitely less fit..bred to be less fit purposely by humans..only for the novelty, or for making money..how can that be considered a good thing?
    Again, you are blurring the line. They are genetically fit. It does not matter if they are physically unfit.

    And please quit harping on the money aspect. I challenge you to find anything in this world that does not come down to money. Our hobby started out cause some redneck hillbilly decided to dig up VFTs from the wild and sell them for their novelty to make a quick buck so our hobby is terrible and horrible.

    All dog and cat breeds are purposefully selected to maintain the breed standard only for the novelty and to make money. All bird and fish and cow and goat and horse and sheep and corn and wheat and bean and mouse and rat and gerbil and... I could go on forever. All of these and more have novelty and, in the end, financial gain for someone. Have you ever owned a dog Scot? Was/were it/they mutt(s)? If you answered "yes" to the first and "no" to the second then you are a hypocrite because you are trashing the maintenance of one breed while perpetuating the maintenance of another.

    Quote Originally Posted by scottychaos View Post
    so the deformity is considered a benefit, because its what the humans select for, thus what I consider a weakness is actually a strength for that variety..
    ok..thats basically logical..
    but it still makes the organism weaker when compared to its natural form..
    And again, we are not talking about "nature" because a Bronx apartment is not natural. Nor is an Atlanta mansion. Nor an L.A. condo.

    And we are not talking about the organism itself but the genes.

    Pug traits survive because humans have selected them..
    therefore Pugs are "fit" for basic survival..
    but its still a very weak, sickly animal in reality..even though it does technically survive through human intervention..
    Exactly

    I see your point..but I still cant accept that these characteristics are actually strengths in reality, because to the organisms themselves, they are real drawbacks..even if they do allow them to actually exist in the first place..
    We are talking about the genes. The traits come from the genes. And technically the traits are not a drawback because if they were then the genes for them would not have been selected.

    The traits of cute cuddly are what made people want them and are what are perpetuated. Yes, hand in hand with cute and cuddly comes breathing problems and what not. Does not change the fact that cute has "survival" value in this novelty oriented culture (and when you consider how old some of these breeds are it is obvious they have very high survival value).

    yes, Persian cats would not even exist, at all, if they hadn't been created artificially..
    but IMO, they shouldn't exist..I consider it cruel to deliberately create animals with deliberate deformities that cause them to have health problems.
    Well, a single personal opinion does not mean much on the broad scale of selection. You do not like them. Fine, no one is asking you to. Heck, I do not much like them either. But some people do and they will maintain the genes in the breed population. Same with Siamese and Rhodesian Ridgebacks. Same with Manx and Bernese Mtn. Same with Tabby and Labrador. Each breed has its own fitness and within the breed it is very fit.

    Quote Originally Posted by scottychaos View Post
    well..yes they are less genetically fit for this environment..
    just because they are less genetically fit, period.
    No. They are perfectly genetically fit for this environment because they have been selected for this environment. They are not "less" genetically fit, they are not "more" genetically fit. They simply are genetically fit. "More" and "less" are subjective. A chihuahua is "more" genetically fit than a St. Bernard when it comes to living in the purse of a Beverly Hills princess. That same chihuahua is "less" genetically fit when compared to that same St. Bernard when it comes to digging a man out of an avalanche. But you cannot make the blanket statement that either animal is "more" genetically fit or "less" genetically fit period end of discussion. With no point of reference there is no "more" or "less"



    Quote Originally Posted by allegedhuman View Post
    When talking about fitness here it should be the biological context of fitness but I am mentioning this point in case some people may be using the common use of fitness to describe physical condition. Biological/genetic fitness of an individual refers to an organisms ability to reproduce and pass on its genes. Basically fitness boils down to how many offspring you leave behind. NOT how physically fit you are or how hardy and vigorously a plant grows, etc.

    I doubt the average show cat, squished-nosed, pedigreed Persian cat would last long having to hunt down meals in the wild compared to a normal cat. Dump both cats off in the wild and in that case your average cat would likely have the higher fitness because it would survive longer and be able to have more litters than the Persian. But compare the same two cats in a domestic situation and chances are the pedigree show cat will be in demand as a sire due to its pedigree and breed while the only action the standard cat would have is what it could sneak on its own, if it wasn't neutered first. Compare that to the persian with a waiting list for breeding opportunities the persian's fitness would be higher.

    There is no one absolute fitness that is THE best. Fitness does matter on the environment. One organism may have a particular set of genes which gives it superior fitness in one environment, say for a plant a wetter one, where it has many offspring but move that same individual to a new environment which is dryer it is less fit if it does not reproduce as well compared to others individuals which have sets of genes which allow them to reproduce better in a dry environment compared to a wet one (and vice versa).

    Not sure if this was a confusion for anyone reading but figured if it was it would clarify what the term fitness is..or should...be referring to.

    Just because that giant steroid pumped muscle-bound guy at the gym might be physically fit (albeit gross looking)...well steroids are not necessarily the best thing for his reproductive fitness due to some..undesirable... side effects
    Thank you Alleged. A wonderful explanation.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

Page 7 of 10 FirstFirst ... 345678910 LastLast

Similar Threads

  1. my fellow newbies...
    By Presto in forum Venus Flytrap (Dionaea ) Care Information & Tips
    Replies: 10
    Last Post: 06-12-2006, 08:07 AM
  2. for newbies
    By Copper in forum Carnivorous Plant Trading Post
    Replies: 7
    Last Post: 03-07-2006, 07:03 PM
  3. my fellow newbies..
    By Presto in forum Venus Flytrap (Dionaea ) Care Information & Tips
    Replies: 18
    Last Post: 03-04-2006, 12:01 PM
  4. Cps for newbies
    By Amateur_Expert in forum Carnivorous Plant Trading Post
    Replies: 2
    Last Post: 11-11-2004, 12:29 PM
  5. Seed packet folding for newbies
    By wickedthistle in forum General Discussions
    Replies: 1
    Last Post: 07-01-2004, 10:30 PM

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •