User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 3 of 4 FirstFirst 1234 LastLast
Results 17 to 24 of 25

Thread: First Time Ever - A Reptile Show in MN!

  1. #17
    swords's Avatar
    Join Date
    Apr 2002
    Location
    Cernunnos Woods
    Posts
    8,121
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    It's true, I've never heard of any of those guys! LOL

    Yeah, I found a frilly forum last week but unfortunately I've read much of it's archives all already, just like the allpet roaches forum, neither must have been up too long.

    I haven't spoken to her about the roaches yet, only to her dad (my uncle) who's into iguanas, he has 2 greens and a rhino. He said he'd ask her if she's interested next time she comes around. He didn't like the crickets she fed her old chameleons when she lived at home cos they escaped and bred, he liked the idea they "can't" breed outside the tubs like crickets.

    What do you feed your roaches to?

  2. #18
    quogue's Avatar
    Join Date
    Aug 2006
    Location
    Long Island, NY
    Posts
    773
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I always liked this guy and his crazy-weird Cobras

    Some cool Cobra pics from the site:
    pic 1
    pic 2

    Seems to have all sorts of crazy stuff!

  3. #19
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by swords View Post
    It's true, I've never heard of any of those guys! LOL
    Yeah, mostly ball python guys. But big names in the BP world.

    Yeah, I found a frilly forum last week but unfortunately I've read much of it's archives all already, just like the allpet roaches forum, neither must have been up too long.
    Let me ask around on my reptile forum and see if anyone there has some direction.

    What do you feed your roaches to?
    Phyllomedusa sauvageii

    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  4. #20
    swords's Avatar
    Join Date
    Apr 2002
    Location
    Cernunnos Woods
    Posts
    8,121
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Are those "Waxy Monkey Frogs"? Their eyes are so weird for some reason!

    I've been curious why are snakes so outrageously expensive? They don't seem to be hard to acquire but they're always high ticket compared to other large reptiles. Do snakes not breed as often as other things?

  5. #21
    swords's Avatar
    Join Date
    Apr 2002
    Location
    Cernunnos Woods
    Posts
    8,121
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Oh the temptation was almost too much but I was able to resist buying a baby frilled dragon they had at the herp shop today as I was looking for an interesting cork bark tube. I want 3 (1 male/2 females) not just one but 1 is one step closer my goal... I suppose getting a single individual from 3 different sources would guarentee they didn't all come from the same parents - I just worry about the possibility of parasites or something from one making the others sick.

  6. #22
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by swords View Post
    Are those "Waxy Monkey Frogs"? Their eyes are so weird for some reason!
    Yes they are

    I've been curious why are snakes so outrageously expensive? They don't seem to be hard to acquire but they're always high ticket compared to other large reptiles. Do snakes not breed as often as other things?
    It all depends on the snake. A normal of most anything is pretty cheap. Corns and Balls and Rats and such are in the $10-15 range. Somethings are a bit more rare or sizable, Carpets and Boas and the like, so they fetch a bit more. And then you get into the morphs... Morphs are the name of the game when it comes to snakes. If a morph is new it fetches top dollar. Things like the Banana Ball are huge money because they are extremely rare. Things like albinos tend to be less expensive because they are not as rare (albino is usually the first morph found in any species.) Clutch size can also make an impact. Example, Albinos in Burmese pythons vs. Ball pythons. Burmese pythons can have 30-50 egg clutches so breed a heterozygous pair and you will certainly get a few albinos out of it. Ball pythons have really small clutches, 4-6 is normal, 8-10 is exceptional. Much harder to get high numbers of the morph from these breedings so there are fewer of them making them more expensive.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  7. #23
    swords's Avatar
    Join Date
    Apr 2002
    Location
    Cernunnos Woods
    Posts
    8,121
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    So, is a morph like a "cultivar" in a way?
    A specimen with really exceptional markings that's pulled out of a clutch of babies? Are these same-clutch babies bred together to continue a morph line? Is that "ok" to do genetically?

    I figured it out, seems like most frogs have horizontal slit pupils and the waxy monkeys have vertical slits. Funny how that would make them look robotic or somehow strange to me.

  8. #24
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by swords View Post
    So, is a morph like a "cultivar" in a way?
    A specimen with really exceptional markings that's pulled out of a clutch of babies? Are these same-clutch babies bred together to continue a morph line? Is that "ok" to do genetically?
    Kind of but not... A "morph" is a distinct genetic mutation, the most obvious one being Albino. Depending on the species you are dealing with there may only be a few morphs but with things like corn snakes and ball pythons there are 60-80 different morphs. Some are subtle and some are quite extreme. And then when you combine different morphs you get even more variety. Taking ball pythons as an example, using just the Albino morph you have:

    Albino
    Albino Axanthic (Snowball)
    Albino Spider
    Albino Pinstripe
    Albino Clown
    Albino Genetic-stripe
    Albino Hypo
    Albino Black Pastel
    Albino Cinnamon
    Albino Piebald
    Albino Yellowbelly
    Albino Ivory
    Albino Pastel
    Albino Spotnose
    Albino Mojave

    And I am probably missing a few in there...

    Anyways, you can see from that short list that you have near infinite variety when you start mixing and matching morphs. If you are ever really bored check out the kingsnake.com classifieds for ball pythons, you can waste hours just looking at pics.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

Page 3 of 4 FirstFirst 1234 LastLast

Similar Threads

  1. New reptile home
    By Ozzy in forum Reptiles, Amphibians and other terrarium dwelling animals
    Replies: 6
    Last Post: 03-14-2008, 09:36 AM
  2. Time to show mine off!
    By glider14 in forum Tropical Pitcher Plants  (Nepenthes)
    Replies: 15
    Last Post: 12-21-2007, 04:32 AM
  3. Reptile show
    By Ozzy in forum General Discussions
    Replies: 26
    Last Post: 09-01-2005, 04:14 PM
  4. It's time to start the show...
    By swords in forum General Discussions
    Replies: 1
    Last Post: 08-09-2005, 07:03 PM
  5. Reptile show!
    By SunPitcher in forum General Discussions
    Replies: 4
    Last Post: 03-09-2005, 10:11 PM

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •