User Tag List

Informational! Informational!:  0
Likes Likes:  0
Results 1 to 5 of 5

Thread: Synthetic Life

  1. #1
    Brokken's Avatar
    Join Date
    Sep 2008
    Location
    San Jose, CA
    Posts
    1,579
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Synthetic Life

    "There is no pain as great as being alive,
    no burden heavier than that of conscious life. "
    -Rubén Darío-

  2. #2
    War. War never changes. Est's Avatar
    Join Date
    Apr 2004
    Location
    Champaign, IL
    Posts
    3,935
    Mentioned
    3 Post(s)
    Tagged
    1 Thread(s)
    I've read a little bit about this but haven't gotten a chance to look in to it... I love Ted Talks, so I'll download the talk some soon and take a look.

    My initial thoughts: Why, oh why, of all the people/institutions to do this, why Craig Venter? It's like Monsanto making a plant that could feed the world...
    ¯\(º_o)/¯ ಠ_ಠ
    My Growlist
    NASC Website Come join in on the fun!

  3. #3
    scottychaos's Avatar
    Join Date
    Aug 2001
    Location
    Western New York, USA
    Posts
    2,970
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    hmmm..I dont know..
    first of all, the concept alone is really scary..*natural* mutant bacteria are bad enough..

    second, its not really *wholly* synthetic..only one small part of it..
    it still needs 99.9% of a real bacteria to "live"..
    its not really a "synthetic cell"..as they claim..
    sounds like only ONE chromosome was created in the computer..

    Isnt it like putting an artificial heart in a human and saying "we have created a synthetic human"?
    yeah, its cool and all, but its not really "a synthetic organism"

    (maybe a better analogy would be a synthetic brain in a human! but even then, you still havent created "Data" from Star Trek....although I suppose this computer generated chromosome is the first step to getting there!

    Scot

  4. #4
    Brokken's Avatar
    Join Date
    Sep 2008
    Location
    San Jose, CA
    Posts
    1,579
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by scottychaos View Post
    hmmm..I dont know..
    first of all, the concept alone is really scary..*natural* mutant bacteria are bad enough..

    second, its not really *wholly* synthetic..only one small part of it..
    it still needs 99.9% of a real bacteria to "live"..
    its not really a "synthetic cell"..as they claim..
    sounds like only ONE chromosome was created in the computer..

    Isnt it like putting an artificial heart in a human and saying "we have created a synthetic human"?
    yeah, its cool and all, but its not really "a synthetic organism"

    (maybe a better analogy would be a synthetic brain in a human! but even then, you still havent created "Data" from Star Trek....although I suppose this computer generated chromosome is the first step to getting there!

    Scot

    I see what you're saying and agree that large portions of the cell are still natural and 'borrowed' but the synthesis of these should be easy by comparison. If we can get on a computer and type analogous pairs of DNA like we would a computer program and create wholy new organisms and then leave behind the biological equivalent of "Killroy was here", that sounds pretty synthetic to me. To use and modify your analogy: it would be more like designing a better heart, growing it and putting it in a human body. Would it be artificial? No, it would be synthetic; hence the distinction.

    It's both exciting and scary at the same time.
    "There is no pain as great as being alive,
    no burden heavier than that of conscious life. "
    -Rubén Darío-

  5. #5
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by Est View Post
    My initial thoughts: Why, oh why, of all the people/institutions to do this, why Craig Venter? It's like Monsanto making a plant that could feed the world...
    It is not all that surprising that JCVI was the group to do this, it is just about the top genetics institute out there and the man himself really is quite a sharp tack.


    Quote Originally Posted by scottychaos View Post
    second, its not really *wholly* synthetic..only one small part of it..
    it still needs 99.9% of a real bacteria to "live"..
    its not really a "synthetic cell"..as they claim..
    It is more synthetic than anything done to date. And "they" never claimed it was a "synthetic cell," that was the glorious media morons.

    "They" called it exactly what it is: Synthetic biology.

    Quote Originally Posted by scottychaos View Post
    sounds like only ONE chromosome was created in the computer..

    Isnt it like putting an artificial heart in a human and saying "we have created a synthetic human"?
    yeah, its cool and all, but its not really "a synthetic organism"
    And when we consider that bacteria only have ONE chromosome your heart/body analogy goes out the window.

    The more accurat analogy to what was done would be to say that the entire innards of a person were made artificial, placed inside a still living human and then their natural organs were used to jumpstart the artificial ones and then the natural ones were removed.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

Similar Threads

  1. New Life!
    By whowe in forum Venus Flytrap (Dionaea ) Care Information & Tips
    Replies: 3
    Last Post: 01-01-2008, 02:36 PM
  2. Life!
    By Ant in forum Venus Flytrap (Dionaea ) Care Information & Tips
    Replies: 3
    Last Post: 04-28-2007, 03:44 PM
  3. What to do with my life?
    By Pyro in forum General Discussions
    Replies: 27
    Last Post: 01-24-2007, 10:44 AM
  4. A day in the life...
    By lithopsman in forum General Discussions
    Replies: 12
    Last Post: 10-03-2004, 06:23 AM
  5. Life of a vft
    By Darwin in forum Venus Flytrap (Dionaea ) Care Information & Tips
    Replies: 7
    Last Post: 05-26-2004, 07:28 AM

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •