User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 6 of 13 FirstFirst ... 2345678910 ... LastLast
Results 41 to 48 of 101

Thread: Which kind(s) of cp do YOU hate?

  1. #41
    mobile's Avatar
    Join Date
    Nov 2007
    Location
    Aberdeenshire, Scotland
    Posts
    1,070
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I don't hate any CPs... but I dislike mutant VFTs, such as fondue, wacky traps etc.

  2. #42
    scottychaos's Avatar
    Join Date
    Aug 2001
    Location
    Western New York, USA
    Posts
    2,970
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I also cant stand the man-made mutant VFT's..poor sad freaks of nature..they shouldn't exist.
    it would make me happy if each time someone discovered one, they destroyed it so that it wouldn't spread..

    I cant stand made-made mutant *anything*..bull dogs, persian cats, parrot cichlids, etc..
    their deformities cause them pain and suffering, and they are created just for the sake of human amusement.. if a VFT cant catch a bug, what is the point of its existence?

    Apart from that, im not a huge fan of pings..grew one once..dont have any currently, and probably will never own another..they just dont do anything for me..

    Scot

  3. #43
    Millipede's Avatar
    Join Date
    Mar 2009
    Location
    oregon
    Posts
    755
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    i dont like drosera adelae. i just dont like it

    other types i just dont care for. non aquatic bladderworts, most butterworts and like many others have said: those stupid mutated flytraps

  4. #44
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote Originally Posted by mato77429 View Post
    What I meant is that people should be able to express an opinion about which neps they like or dislike (love or hate). ... I think you would agree that there needs to be a level of understanding among members that others may have different opinions.
    My comment was more directed as a shotgun blast over all rather than a rifle shot at one.

    I understand your intent and I agree that members should be able to express their opinions on likes and dislikes... I am all for people having friendly discussions about their likes and dislikes as long as they keep it civil. But... It almost always happens that when the discussion become less than friendly and the Mods are forced to censure the thread that people inevitably, play the "Freedom of Speech" card and people start to cry foul about suppression and the thread is well and thoroughly lost. I just wanted to cover why it is necessary and right for the Mods to edit and what brings it about. Generally we do not like acting. But we like it even less when we get lambasted for it.


    And back on topic of what plants I do not like... Any Drosera that falls under the term "green rosettey thing"
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  5. #45
    BANNED
    Join Date
    Aug 2011
    Location
    Cascadia Subduction Zone
    Posts
    2,113
    Mentioned
    2 Post(s)
    Tagged
    0 Thread(s)
    I think I'm also going to have to add the poor, retarded, and mutated VFTs. Just seems too Dr. Moreau for me.

  6. #46
    Doomsday's Avatar
    Join Date
    Mar 2010
    Posts
    562
    Mentioned
    3 Post(s)
    Tagged
    0 Thread(s)
    My offer still stands.. If any of you happen to come across a mutant deformed hideous freak of nature in your collection be it from seed or a cloning mutation or a trade throw in, and you don't love it, I'd be glad to take it off your hands for you and give it a caring home. Can be any type of cp

  7. #47
    Millipede's Avatar
    Join Date
    Mar 2009
    Location
    oregon
    Posts
    755
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    LOL ive seen that movie. good reference

  8. #48
    mass's Avatar
    Join Date
    Feb 2010
    Posts
    8,144
    Mentioned
    1 Post(s)
    Tagged
    0 Thread(s)
    LL neps. They're so cool and I can't grow them. Which of course makes me hate (want) them even more. Might as well through helis in here for the same reason.

Page 6 of 13 FirstFirst ... 2345678910 ... LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •