User Tag List

Informational! Informational!:  0
Likes Likes:  0
Results 1 to 6 of 6

Thread: AVATARS

  1. #1
    Moderator
    Join Date
    Jul 2001
    Location
    San Antonio, Texas; USA
    Posts
    2,363
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hi Guys,

    This is just a precautionary statement, because as far as I know, we have not recieved any complaints. But here is the deal.

    You have the option to use a custom avatar on this site. You can pretty much plug any picture you want.

    However, please ensure that the picture you are using is either public domain, or you have obtained permission to use it.

    Under no circumstances should you link directly to another companies (Or this one for that matter) page to pull a picture off their site over here for use as an avatar. In effect, when you are doing that, you are stealing bandwidth.

    The long and short it, we don't want another company to have the opportunity to get fussy over this, so were asking you to head it off at the pass by just not doing it.

    Thanks so much.
    \"Maybe in order to understand mankind, we have to look at the word itself: \"Mankind\". Basically, it\'s made up of two separate words - \"mank\" and \"ind\". What do these words mean ? It\'s a mystery, and that\'s why so is mankind.\" ~ Jack Handey

  2. #2
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    As a quick follow up, there was a complaint on this recently but it was successfully and rapidly fixed.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  3. #3
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Unhappy

    Hey guys,
    I have a picture on my hard drive that I would like to upload and use as my Avatar....Can I do that?
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  4. #4

    Join Date
    Jul 2002
    Posts
    126
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    ya me too is it even possible if not how do I get one off the net I dont quite know how
    The medicated state of mind you find is overrated

  5. #5
    Moderator
    Join Date
    Jul 2001
    Location
    San Antonio, Texas; USA
    Posts
    2,363
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    you will need to obtain webspace on a server to upload your pics to... used to be you could use geocities and such, but I think they have rules against it now...

    but yes, you can upload images and use them, where ya think the mallet in my avatar came from! [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]
    \"Maybe in order to understand mankind, we have to look at the word itself: \"Mankind\". Basically, it\'s made up of two separate words - \"mank\" and \"ind\". What do these words mean ? It\'s a mystery, and that\'s why so is mankind.\" ~ Jack Handey

  6. #6
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Arrow

    Ok, just took my avatar from my own websight....let's see how it looks!

    By the way, if you're wondering, it'w the websight for my karate school.... [img]http://www.**********.com/iB_html/non-cgi/emoticons/wow.gif[/img]
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •