User Tag List

Informational! Informational!:  0
Likes Likes:  0
Results 1 to 7 of 7

Thread: Question about radioactive plants

  1. #1
    LoggerHead
    Guest
    I just fertilized my fly trap with a spoonful of plutonium. Will it die?

  2. #2
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    LoggerHead,

    Ummmm.... Where did you get the Plutonium? (just curious as I need some to take over the world [img]http://www.**********.com/iBhtml/non-cgi/emoticons/smile.gif[/img] )

    Since all living tissue is vulnerable to radioactivity I would be inclined to say that your VFT will be adversly affected and there is probably a good chance it will expire.

    Pyro
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  3. #3

    Join Date
    Feb 2002
    Location
    menomonie
    Posts
    1,101
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Interestingly, I've been reading a book on plant breeding. There's a technique called 'mutagenic breeding' where you take seeds and expose them to radiation, or other mutagen, plant them and basically see what you get. 99.9% of the time, you end up with a lethal gene and nothing happens, but that 0.1% of the time you can end up with some interesting stuff. I wish I had the book on me, because it listed some interesting examples.

  4. #4

    Join Date
    Feb 2002
    Posts
    432
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I was kind of wondering the same thing as Pyro!
    BTW, What isotope is it!

  5. #5
    Guest
    Just kidding!

    Did I fool anyone?

  6. #6

    Join Date
    Apr 2002
    Location
    Los Angeles, CA
    Posts
    809
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hey Sarracenia,

    Mutagen is what they used to create the Teenage Mutant Ninja Turtles.
    [img]http://www.**********.com/iBhtml/non-cgi/emoticons/wow.gif[/img]
    A flytrap ate my homework!
    -Michelle

  7. #7

    Join Date
    Mar 2002
    Posts
    1,338
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Next thing you know, he'll be dusting his plants with anthrax for pest control. [img]http://www.**********.com/iBhtml/non-cgi/emoticons/mad.gif[/img]
    There's a tunnel at the end of the light...

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •