User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 3 123 LastLast
Results 1 to 8 of 23

Thread: West Nile Virus

  1. #1
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hi everybody,

    Thought I'd do a little public service announcment after my wife jumped on me last night about there being "so many mosquitoes" out around my CPs

    This is an excellent link to the CDC page on West Nile and the mosquitoes involved. Also, here is a pic of the most common carrier mosquito Culex




    A little trick to help keep this Genus of mosquito from hanging out in your CP trays is to go with the "fill when dry" method of watering as Culex only breed in permanent standing water and not 'flood and dry' water holes.

    Also of note is the fact that West Nile only tends to be a problem in people over 50 and under 10.

    So everybody be safe around your CPs [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  2. #2
    Moderator
    Join Date
    Jul 2001
    Location
    San Antonio, Texas; USA
    Posts
    2,363
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    There is also the fun trick of using a tooth pick to get a drop of oil and then dipping it in your water.

    The oil (vegetable) will spread out into a super thin sheet that floats ontop of your water, (won't hurt your plants) and prevent the mosquito larvae from breathing... death to skeeters...

    [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]

    course.. since Magore sent me some U. Gibba my outdoor tray is now home to mosquito ####! [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]
    \"Maybe in order to understand mankind, we have to look at the word itself: \"Mankind\". Basically, it\'s made up of two separate words - \"mank\" and \"ind\". What do these words mean ? It\'s a mystery, and that\'s why so is mankind.\" ~ Jack Handey

  3. #3

    Join Date
    Mar 2002
    Location
    Ontario
    Posts
    1,341
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I heard on the news that you could only get the virus thru human - dead bird contact...

  4. #4
    Moderator
    Join Date
    Jul 2001
    Location
    San Antonio, Texas; USA
    Posts
    2,363
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    your news is wrong, west nile is transmitted by mosquitos, but is incubated in birds and humans alike... the only known vector is the mosquito... you can not get it from either birds or humans. it is not spread through touch, aresol, or any other fashion that one of those little buggers plunging it's sucker into you.
    \"Maybe in order to understand mankind, we have to look at the word itself: \"Mankind\". Basically, it\'s made up of two separate words - \"mank\" and \"ind\". What do these words mean ? It\'s a mystery, and that\'s why so is mankind.\" ~ Jack Handey

  5. #5

    Join Date
    Mar 2002
    Posts
    1,338
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I hope I don't get it... I get bit at least 5 times a day. [img]http://www.**********.com/iB_html/non-cgi/emoticons/sad.gif[/img]
    There's a tunnel at the end of the light...

  6. #6

    Join Date
    Feb 2002
    Posts
    432
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    It's not as deadly as the media would like you to think......

  7. #7

    Join Date
    Feb 2002
    Location
    South Florida
    Posts
    651
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    its killed about 6 in lousiana and infected about 64

    not deadly?
    Expression = Maneuverability x Coiffure squared

  8. #8

    Join Date
    Feb 2002
    Location
    z11 Puerto Rico
    Posts
    507
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Exclamation

    I read somewhere that 500 people die every year from falling out of their beds... [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] How many people have died from this virus in the last few years? I think this is totally hyped too much. I'd be more afraid of getting dengue fever than west nile virus... but that's just me.

    Joel



    http://homepage.mac.com/mindmaze128/...lood forum.jpg
    Joel Martínez
    San Juan, Puerto Rico, USA

Page 1 of 3 123 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •