User Tag List

Informational! Informational!:  0
Likes Likes:  0
Results 1 to 6 of 6

Thread: strangest stories

  1. #1

    Join Date
    Jun 2002
    Location
    toronto
    Posts
    147
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Question

    have you ever had strange things happen with your plant ?
    --not growing right even though you have all the right conditions ?
    -- thought it was one species and it was a completely different one ??
    -- had a hybrid and only found out once different types of leaves and colours came out ??
    --grew REALLY fast even though you thought you gave it too much fertilizer or mineraled water by accident !?
    Tell is your stories and be specific, thx

  2. #2
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    The stranges thing I had happen with my plants was that one day I came home to find the maintance man in my apartment (this was back in Colorado.) When I asked why he was there he said he just wanted a closer look at my cool plants.

    When I reported him for being in my apartment without permission he changed his story to "I thought it looked like marajuanna and I wanted to check as is my duty." So I brought the Nepenthes in question to the manager just to point out how unlike marijuanna it was.

    Needless to say, Mr. Fix It was fired.

    Pyro
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  3. #3
    Shoopdawoop
    Join Date
    Apr 2001
    Location
    San Ramon, California
    Posts
    233
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Ha! thats a good one pyro!
    Oh boy.

  4. #4

    Join Date
    Jun 2002
    Location
    toronto
    Posts
    147
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    hehehe marijuana, thats like so unlikely

  5. #5
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Gadzooks! What would happen to you if you smoked it
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  6. #6

    Join Date
    Jun 2002
    Location
    NH (Zone 5)
    Posts
    316
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I can see it now... "Hey man, whatcha doin'?" "Oh, not much, just smoking some nepenthes."
    "Oh, I see."

    *NOTE TO EVERYONE*
    That comment was meant as a joke, no harm done. If you are offended, I am sorry. There was no offensiveness meant.
    \"Are you suggesting coconuts migrate?\"

    \"If vegans love animals so much, why do they eat all thier food?\" - Brandonk

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •