User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 4 of 15 FirstFirst 1234567814 ... LastLast
Results 25 to 32 of 115

Thread: What is your growlist?

  1. #25

    Join Date
    Jul 2001
    Location
    somewhere in NJ
    Posts
    1,230
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Arrow

    Nepenthes:
    N. Sanguniea (2)
    N. Ventricosa
    N. Truncata
    N. Ampullaria "Green" (2)
    N x Ventrata

    waiting for N. Raffelsiana

    Sundews: (thxs Tamlin)
    D. Alaciae
    D. Aledae
    D. Spathulata
    D. Burmunii "red tentacles"

    Bladderworts: (thxs Pyro)
    U. Calycifida
    U. Tricolor

    Living Spaghnum Moss

    That's it for now. [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img]

  2. #26
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Carnivorous Plants

    U. reniformis “Large form”**
    U. humboldtii**
    U. nephrophylla
    U. alpina
    U. asplundii
    U. unifolia (possibly praetermissa)**
    U. sandersonii ‘blue flower’
    U. longifolia ‘alba’
    U. longifolia**
    U. calycifida
    -Type
    -‘Mrs. Marsh’
    -‘Cthulho’
    -‘Yog-Sothoth’
    -‘Asenath Waite’
    -‘Lavinia Whateley’
    U. dichotoma
    U. dichotoma ‘Turoa NZ’
    U. tricolor
    U. livida
    U. livida ‘South Africa colour variant’
    U. praelonga
    U. lateriflora
    U. pubescens
    U. biloba**
    U. blanchetii**
    U. uliginosa
    U. arenaria
    U. paulinae
    U. delicatula ‘Lake Ohia NZ’
    U. simulans
    U. resupinata
    U. welwitschii**
    U. prehensilis
    U. graminifolia**

    G. hispidula
    G. violacea ‘giant’ (plant and cutting)
    G. violacea
    G. sp ‘Itacambira Beauty’
    G. pygmaea
    G. repens**
    G. pallida**
    G. aurea
    G. filiformis (cutting)**
    G. lobata x violacea
    G. ABG unknown (possibly hispidula)

    N. ventricosa
    N. khasiana
    N. faizaliana
    N. veitchii ‘lowland’

    H. heterodoxa x minor

    Darlingtonia

    D. cistiflora ‘Red Giant’
    D. gigantea ‘Rock Creek’**
    D. gigantea ‘Gold green, Sullivan Rock, WA’**
    D. stolonifera
    D. whittakeri ssp whittakeri
    D. fimbriata
    D. nitidula ‘Collie’
    D. mannii
    D. nitidula x pulchella (?)
    D. ericksoniae x pulchella
    D. palacea ssp. trichocaulis (gemmea)
    D. (?) unknown pygmy
    D. binata multifida extrema
    D. x ‘Martson Dragon’ (?) (May actually be dichotoma)
    D. indica
    D. madagascariensis var. ‘Botswana’
    D. falconerii
    D. paradoxa x petiolaris
    D. neo-caledonica**
    D. slackii
    D. sp ‘Borneo’

    P. moranensis
    P. moranensis “ABG clone”
    P. moranensis var. cuadata ‘Longwood’
    P. ehlersai
    P. potosiensis
    P. cyclosecta
    P. cyclosecta “Dark purple flower” YuccaDo ABG 97-1714 60-45-031495A
    P. cyclosecta “Light lilac flower” YuccaDo ABG 97-1715 60-45-031395B
    P. emarginata
    P. laueana
    P. gigantea
    P. zecheri
    P. rotundiflora
    P. agnata
    P. agnata “fragrant flower”
    P. debbertiana
    P. oblingiloba
    P. gracilis
    P. gypsicola (cuttings)**
    P. YuccaDo locations
    -ABG 97-1713 60-19-031695
    -ABG 97-1716 6-14-99/7-25-00
    -ABG 97-1717 60-45-031395C
    -ABG 97-1718 grandiflora (?)
    P. ‘George Sargent’
    P. ‘Aphrodite’
    P. agnata x gypsicola

    S. oreophila
    S. minor
    S. leucophylla ‘Tarnok’
    S. purpurea ssp montana
    S. purpurea ssp venosa “deep purple”
    S. cv ‘Mardi Gras’
    S. cv ‘Dixie Lace’

    S. leucophylla (sprouts)

    Dionaea
    -common
    -Red Dragon
    -Green Dragon
    -Dentate


    Other Plants

    Avocado
    Orange
    Pineapple
    Mimosa
    -Large Form
    -Medium Form
    Ant Plant
    -Hydnophytum sp.
    - Dischidia pectinoides
    Disa uniflora
    Red Ginger (Alpinia purpurata)
    Banana (Musa velutina)
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  3. #27
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Lightbulb

    HOLY MOLY!!
    Some of you guys could really hide the bodies!! [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img]
    Here's mine:
    VFT's: Typical, green dragon, Dente, unknown giant, unknown all red, red dragon

    Sars: Purpurea ssp Venosa, Flava, Rubra, x 'Judith Hindle', leucophylla RED, leucophylla, 3 unknown seedlings, psittacinna (sp?), minor, alata and
    Purpurea ssp Purpurea should be here in a few days....

    Drosera: Capensis (typical, red form and "alba", giant, alba giant, narrow leaf), Spatulata, Adelae , Aliciae , Angelica caxhi, Burmanii red tentales, rotundifolia, intermedia

    Utrics: Radiata, Faccida(sp?) and Livida

    Neps: Truncata, Gracilis, Ampularia, Xjudith Finn (I think, really X little pot of horrors), X coccinea, Bicalcarata, Merilliana, x ventrata, ventricosa, sanguinea, Aristolochioides, albomarginata , campanulata, eustachya redxpurple, reinwardtiana (highland)

    Pings: Moranensis and Primuliflora

    Non CP's
    Aloe, papaya, one completely unknow bush (gift), a BIG jade plant, bonsai tree, and christmas cactus

    edited on 06/19/03
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  4. #28
    pthiel's Avatar
    Join Date
    Mar 2002
    Location
    Central Ohio
    Posts
    195
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Well here is my list - as up to date as I ever seem to be able to keep it.

    Cephalotus Follicularis


    Dionaea Muscipula

    cuptrap
    dente
    'Fine tooth x Red'
    'Giant'
    Red Piranha
    Red Purple
    typical

    Drosera

    "coccicaulis"
    adelae
    aliciae
    anglica
    anglica 'CA x HI'
    anglica Hawaii
    arcturi
    binata
    brevifolia x capillaris
    brevifolia x intermedia
    broomensis
    burkeana
    burmanii 'all green'
    burmannii 'red tentacle'
    caledonica
    capensis "giant"
    capensis 'Alba'
    capensis 'all red'
    capensis typical
    capensis 'wide leaf'
    capensis x aliciae ?
    capensis x rubra
    capillaris
    capillaris 'long arm'
    closterostigma
    communis
    darwinensis
    derbyensis
    dichrosepala ssp. dichrosepala
    dilatato-petiolaris
    echinoblasta
    ericksoniae
    ericksoniae x pulchella
    esmeraldae
    esterhuysenae
    falconeri
    falconeri x darwinensis
    filiformis `California Sunset`
    filiformis 'all red'
    filliformis ssp traycii
    fimbriata
    gigantea
    graminifolia
    hamiltonii
    hyperostigma
    intermedia
    intermedia 'Cuba'
    macrantha ssp. macrantha
    madagascariensis
    mannii
    microscapa
    minitata
    montana tomentosa
    montana tomentosa (very hairy)
    montana var montana
    multifida 'extrema'
    nidiformis
    nitidula ssp. allantostigma
    nitidula ssp. allantostigma x ericksoniae
    nitidula ssp. leucostigma
    nitidula ssp. nitidula var. nitidula
    nitidula ssp. nitidula var. nitidula x pygmaea
    nitidula ssp. nitidula x occidentalis
    nitidula ssp. omissa x occidentalis
    nitidula ssp. omissa x pulchella
    occidentalis x warriup
    oreopodion
    palacea var palacea
    paradoxa
    paradoxa x lanata
    pulchella coral flower
    pulchella orange flower
    pulchella pink flower
    pulchella x nitidula
    pycnoblasta
    regia
    roraimae
    roseana
    rotundifolia
    rotundifolia x intermedia
    sargentii
    scorpioides
    sessilifolia
    slackii
    sp 'Palmeit 30.3.81'
    sp 'Rhodesia'
    sp. 10 Erect
    sp. 'Caledon 1995'
    sp. 'Emas'
    sp. 'small white flower'
    spatulata
    stelliflora
    stenopetala
    unknown S. African
    unknown S. American
    x 'Lake Badgerup'
    x snyderi

    Heliamphora

    heterodoxa
    heterodoxa x minor
    minor
    nudoxa (nutans x heterodoxa)

    Nepenthes

    (dubia X singalana) X ?
    alata (Highland)
    alata (Lowland)
    albomarginata
    ampullaria
    ampullaria 'Cantley's Red'
    argentii
    bellii
    bicalcarata 'red flush'
    bicalcarata 'yellow/orange'
    burbidgeae
    burkei
    clipeata
    copelandii
    danseri
    deaniana
    distillatoria (pink)
    distillatoria (purple)
    distillatoria (yellow/green)
    ephippiata
    faizaliana
    fallax
    fusca
    gracilis
    insignis
    jacquelineae
    khasiana
    lowii
    macfarlanei
    madagascariensis
    maxima (Irian Jaya)
    maxima '166'
    maxima 'dark'
    maxima 'max-22'
    maxima 'T130'
    maxima x ventricosa
    merrilliana
    mindanaoensis
    mirabilis
    mirabilis (echinostoma)
    mirabilis x ampullaria
    northiana
    pilosa
    rafflesiana (elongata)
    rafflesiana (Giant)
    rafflesiana (Pale Green)
    rafflesiana (White)
    rafflesiana typical
    rafflesiana x ampullaria
    rajah
    ramispina
    reinwardtiana
    sanguinea
    sibuyanensis
    singalana
    spathulata
    tentaculata
    thorellii
    tobaica x maxima
    tomoriana
    truncata
    truncata (Highland)
    truncata x merrilliana
    truncata x veitchii
    veillardii
    veitchii
    veitchii x ampullaria ?
    veitchii x maxima xx mixta
    ventricosa
    ventricosa x talangensis
    villosa
    x cantleyii
    x coccinea
    x hookeriana
    x 'Judith Finn'
    x leesii
    x merrilliata
    x pangulubauensis
    x rokko
    x splenda
    x trichocarpa
    x ventrata
    x ventricosa hybrid

    Genlisea

    sp. itacambira
    violacea
    violacea 'giant'

    Pinguicula

    'Florian' (=P. jaumavensis x debbertiana)
    ´Aphrodite´ (agnata 'scended flower' x moctezumae)
    agnata 'True Blue'
    agnata x gypsicola
    caerulia
    colimensis
    cv 'Harold'
    cyclosecta
    ehlersae
    emarginata Wistuba x caudata 'A'
    emarginata x cyclosecta
    emarginata x moctezumae
    esseriana
    filifolia
    filifolia x moctezumae
    'George Sargent'
    gigantea
    gigantea x moctezumae (H. Luhrs)
    gracilis x moctezumae
    gypsicola
    hemiepiphytica
    immaculata
    ionantha
    kondoi
    laueana
    macrophylla
    medusina
    moctezumae x emarginata
    moranensis
    moranensis 'el chico'
    moranesis var caudata
    oblongiloba
    planifolia
    potosiensis
    primuliflora
    pumila 'yellow throat/light purple'
    rectifolia
    rotundifolia
    'Sethos'
    vulgaris
    zecheri

    Sarracenia

    flava (red tube)
    minor x purpurea x flava
    oreophila
    purpurea ssp purpurea
    purpurea ssp venosa
    rubra x courtii x leucophylla chipola

    Utricularia

    calycifida 'Asenath Waite'
    calycifida 'Lavinia Whateley’
    calycifida 'Mrs. Marsh'
    calycifida 'Yog-Sothoth’
    humboldtii
    livida
    longifolia
    sandersonii
    subulata
    tricolor

  5. #29

    Join Date
    Oct 2001
    Location
    Bavaria, in the South of Germany
    Posts
    319
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Here is my small list. I'm not collecting everything I can get because of limited space and time. I try to grow I wide selection of species with interesting trapping mechanism and which look really different (One reason why I'm not very interested in "rare" tropical Drosera with nice names which all look like Dr. saptulata (and in 95% _are_ D. spatulata))

    My main interest is in Heliamphora, tuberous Drosera and Roridula.

    Excuse the German additions please. I added the list per copy and paste from my German homepage.

    +++++++++++++

    Aldrovanda vesiculosa (japanischer Klon)

    Brocchinea reducta(?) [carnivor?]

    Byblis liniflora [carnivor?]
    Byblis rorida

    Catopsis berteroniana [carnivor?]

    Cephalotus follicularis

    Darlingtonia californica

    Dionaea muscipula 'Typical'
    Dionaea muscipula 'Red burgundi'
    Dionaea muscipula 'shark teeth'
    Dionaea muscipula 'dentata'

    Drosera adelae
    Drosera aliciae
    Drosera andersoniana 'white flower' (Zwiebeldrosera)
    Drosera anglica
    Drosera auriculata (Zwiebeldrosera)
    Drosera binata 'T-Form'
    Drosera bulbosa 'major' (Zwiebeldrosera)
    Drosera burmanni
    Drosera callistos (Zwergdrosera)
    Drosera capensis
    Drosera dichrosepala (Zwergdrosera)
    Drosera enodes (Zwergdrosera)
    Drosera erythrorhiza div. ssp. (Zwiebeldrosera)
    Drosera falconeri
    Drosera filiformis ssp. filiformis
    Drosera gigantea (Zwiebeldrosera)
    Drosera hamiltonii
    Drosera heterophylla (Zwiebeldrosera)
    Drosera intermedia
    Drosera lanata
    Drosera macrantha div. Typen (Zwiebeldrosera)
    Drosera macrophylla ssp. monantha (Zwiebeldrosera)
    Drosera madagascariensis
    Drosera neocaledonica
    Drosera nidiformis
    Drosera pauciflora
    Drosera peltata (Zwiebeldrosera)
    Drosera petiolaris
    Drosera platypoda (Zwiebeldrosera)
    Drosera prolifera
    Drosera ramellosa (Zwiebeldrosera)
    Drosera regia
    Drosera roraimae (Gran Sabana)
    Drosera roseanna (Zwergdrosera)
    Drosera rosulata (Zwiebeldrosera)
    Drosera rotundifolia
    Drosera salina (Zwiebeldrosera)
    Drosera sargentii (Zwergdrosera)
    Drosera schizandra
    Drosera scorpioides (Zwergdrosera)
    Drosera spatulata
    Drosera stolonifera div. ssp (Zwiebeldrosera)
    Drosera venusta
    Drosera whittakeri ssp. aberrans (Zwiebeldrosera)
    Drosera zonaria (Zwiebeldrosera)
    Drosera - nicht identifizierte Zwiebeldrosera

    Drosophyllum lusitanicum

    Genlisea violacea

    Heliamphora heterodoxa
    Heliamphora hispida
    Heliamphora ionasii
    Heliamphora minor (vom Auyan & Akopan Tepui)
    Heliamphora nutans (vom Tramen Tepui & Typ Giant ?)
    Heliamphora spec. (vom Ilu Tepui, es ist aber ungewiß, ob es sich um H. spec 'Ilu' handelt; bildete bisher nur juvenile Schläuche)
    Heliamphora tatei var. neblinae
    Heliamphora tatei var. tatei
    Heliamphora minor x heterodoxa

    Nepenthes aristolochioides
    Nepenthes hamata
    Nepenthes inermis
    Nepenthes khasiana
    Nepenthes lowii
    Nepenthes macfarlanei
    Nepenthes maxima
    Nepenthes murudensis
    Nepenthes rajah
    Nepenthes truncata
    Nepenthes veitchii 'Hochlandform'
    Nepenthes villosa
    Nepenthes ventricosa x inermis

    Pinguicula grandiflora
    Pinguicula gypsicola
    Pinguicula heterophylla
    Pinguicula x 'Sethos'

    Roridula dentata [carnivor?]
    Roridula gorgonias (& Pameridea marlothii) [carnivor?]

    Sarracenia alata
    Sarracenia flava
    Sarracenia leucophylla
    Sarracenia minor
    Sarracenia oreophila
    Sarracenia psittacina
    Sarracenia purpurea ssp. purpurea
    Sarracenia purpurea ssp. venosa
    Sarracenia rubra ssp. alabamensis

    Utricularia blanchetii
    Utricularia endresii
    Utricularia humboldtii
    Utricularia longifolia
    Utricularia menziesii (Knollen-Utricularia)
    Utricularia nelumbifolia
    Utricularia nephrophylla
    Utricularia quelchii
    Utricularia reniformis 'small'
    Utricularia subulata

  6. #30

    Join Date
    Oct 2001
    Location
    Bavaria, in the South of Germany
    Posts
    319
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hi Pete !

    you are growing Nepenthes jacquelineae ? Wow !
    Can you tell us how it is doing in cultivation ? (maybe in the Nepenthes forum ?)

    Martin

  7. #31

    Join Date
    Sep 2002
    Location
    Central Coast of California
    Posts
    3,928
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Arrow

    [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]

  8. #32
    goldtrap2690's Avatar
    Join Date
    Sep 2002
    Location
    San Francisco
    Posts
    1,390
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Here are my plants , this post was edited on 2-7-04 , about 1 year later :

    VFT's :
    typical
    dente
    red variety
    giant
    blood red trap
    fine tooth x red
    green dragon
    red dragon
    big mouth

    SARR's :
    purpurea venosa
    oreophila
    rubra ?
    flava mixed
    rubra rubra
    pssitacina
    minor
    leucophylla
    leucophylla red
    leucophylla tarnok
    x catesbaei
    x judith hindle
    x wrigleyana
    x mixed ?
    alata
    2 unknown seedlings
    pft grab bag plants
    x cobra nest
    rubra alabamensis
    rubra jonesii
    x excellens

    DEWs :

    capensis typical
    capensis narrow
    capensis alba
    capensis red
    spatulata
    adelae
    dielsiana
    aliceae
    nidiformis
    intermedia
    pulchella x nitidula
    unknown pygmy
    binata
    cap giant
    spatulata ' frazier island '
    scorpiodes
    paleacea ssp ? #1
    paleacea ssp stelliflora
    erickoneae x pulchella
    paleacea ssp roseana
    filformis filformis
    filformis tracyii
    cappilaris ?
    rotundifolia

    NEPs :

    ventricosa
    gracilis
    rafflesiana
    sanguinea
    3 mystery gublers hybrids
    x coccinea
    x judith finn
    x ventrata
    x rokko
    ventricosa 'red'

    PINGs :

    primuliflora
    x sethos
    moranensis ?
    moranensis

    UTRICs :

    gibba
    subalata
    sandersonii
    sandersonii ' blue flower '
    livida
    longifolia
    dichotoma
    tricolor
    monanthos
    praelonga
    pubescens
    unknown mixed aquatic variety

    MISC :

    cephalotus follicularis
    darlingtonia californica
    brocchinia reducta
    genlisea hispidula
    genlisea lobata x violacea
    heliamphora heterodoxa x minor

    COMING SOON :
    s. x moorei
    s. x 'ladies in waiting'
    s. x 'mardi gras'
    n. x ventrata
    n. maxima
    n. alata

    SEEDS GERMINATING :

    ibicella lutea
    d. capillaris
    d. capensis alba
    s. flava
    s. leucophylla
    s. rubra ssp jonesii
    s. purpurea ssp purpurea
    dionaea muscipula mixed types
    d. stolonifera ssp stolonifera
    d. rotundifolia manchester New Jersey
    d. rotundifolia traunstein Germany
    d. rotundifolia anchorage Alaska
    d spatulata kanto
    d. tokaiensis
    d. intermedia traunstein Germany
    d. anglica kasilok Alaska
    d. anglica california x hawaii
    d. binata coromandel New Zealand
    d. burmanii
    d. capillaris pasco co. Florida
    d. glanduligera
    d. indica
    d. intermedia cuba
    d. intermedia manchester New Jersey
    d. intermedia north carolina
    d. intermedia Rhode Island
    d. intermedia luepa Venezuela
    d. intermedia vilas co. Wisconsin
    n. rafflesiana
    u. multifida

Page 4 of 15 FirstFirst 1234567814 ... LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •