User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 2 of 4 FirstFirst 1234 LastLast
Results 9 to 16 of 25

Thread: Many thanks! To name a few professionals

  1. #9
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Thumbs up

    Quote
    Here here... I'll drink to that! (But then again I'll drink to most anything.) [/QUOTE]

    Dyflam, we gotta party....

    True, true...This is the first sight I haven't been "yelled" at for asking "stupid" questions....Of which I hope I ask fewer now.. [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img] Anyway, I've learned tons from what people have told me, and reading older posts. Now it's kinda fun to pass on the info to people that are even newer than I.

    And people don't groan too badly when I crack a bad one, as I am want to do....
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  2. #10
    larry's Avatar
    Join Date
    Feb 2002
    Location
    Southern California
    Posts
    1,724
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I've known about the cp listserv for a while. I've read the posts, but have never posted myself. The people there are elitists and love to argue. I don't need that. This place is so much better.
    larry
    http://www.flickr.com/photos/bigflytrap/
    Save a tree, legalize cannabis.
    Be enlightened

  3. #11
    pthiel's Avatar
    Join Date
    Mar 2002
    Location
    Central Ohio
    Posts
    195
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Well, I am going to take the unpopular side of this and defend the listserv. I disagree that the listserv is composed of only elitists and those who love to argue. There are alot of truly good helpful people who frequent the listserv and offer alot of advice and experience to others. Unfortunately the listserv is unmoderated and as anything that involves a group of people you will get that 1% that makes the most noise and gets the most attention. I have spent alot of time formatting the old listserv archives and making them searchable so I have read alot (almost 10 years worth) of the posts and have found an incredible amount of information available in them on questions I did not even know enough to ask. Do not write off the listserv because 1 or 2 people want to argue about something, ignore them (which drives them crazy) and read the information that is being made available. And try to understand some of the people who post there are the same people taking their time to go climb the tepuis to discover and identify new species and get them into cultivation, they probably do not have the free time to answer on why you cannot use tap water on your vft, not a criticism on the question itself it is just that that information is easily obtainable from a hundred other locations and they will spend their time on something not so easily obtainable.

    My two cents & Cheers,

  4. #12

    Join Date
    Dec 2001
    Location
    Oswego, New York, U.S.A.
    Posts
    5,290
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I want to say that I agree with Pete. Although initially irritated with the comments of a few poisionous individuals, I do not want the members here to think that I do not hold the listserve, and the ICPS, in high regard. I do. Without the contributions made by the ICPS, we would be in the dark ages still. The listserve is a fantastic resource: in it's archives almost every CP question that can be asked has been answered.

    Most ICPS officers are my personal friends, and have helped me immesurably in my work and studies. These men of great accomplishment still have the grace to look kindly on my humble work, and offer their invaluable help and insight whenever I have need: and I am not even an ICPS member!

    My concepts of Stewardship of plants vs Ownership stem directly from Dr. Barry Meyers-Rice's inspiration.

    There will always be those of overwhelming ego, diminuative intelligence and loud mouths who find nothing as sweet as the odor of their own....well, you get the point. Let's not judge the orchard by the worm in the apple.

    However, you may rest assured that if that particular broken wheel squeeks again, I am ready with MY oilcan. So, hats off to Phill and Jaie for affording us this forum, and also to the great men behind the ICPS listserve, and it's many, many kind, skilled, and dedicated members.
    "Grow More, Share More"

  5. #13

    Join Date
    Mar 2001
    Location
    texas
    Posts
    434
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Exclamation

    All right. Let me clear this up. I have great respect for the ICPS and those on the CP listserv who have dedicated so much to furthering interest and knowledge in CPs. Many of those members are well known in the field and are probably not the people who made disparaging remarks about this site. I should have replaced the word "many" with the word some in my initial post regarding elitist views.
    In my followup post I did ask for us to consider all sources and value each of those sources for their respective contributions. It is obvious that the CP listserv is an overall
    great place to find information regarding CPs albeit perhaps not at the beginner level.
    So in essence I agree with Tamlin and Pthiel. If they say the majority of the members of the listserve are good folks I am inclined to go along with that view as I trust their judgement.
    I also know that Phil has had contact with Dr.Barry Meyers-Rice and holds him in high esteem...as well he should.
    I did not mean to stir anything up...just to thank those who came to the defense of Exotic Gardens/********** as yet another option for some people.



    The opinions expressed here are not necessarily those of the management. And the management will be happy to hear that!

  6. #14
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Greenhouse,

    Well we all appreciate your thanks but you forgot to thank the one who started it. He may not be as verbally gifted as Tamlin amd Mike King and Joseph but he tries and he did have a few good comebacks [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img]

    I also fully agree with Tamlin and Pete, the list is a great resource and I do recommend that other growers use it as well. I have met many great growers via the list and corespond with many of them on a personal level. Sure there are a few on there who will loudly and publicly proclaim their dislike for newbies. If you can weather their storms though, you will often be contacted off list by others who are more than happy to talk to you and don't mine if you are new to CPs, old to CP or in between.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  7. #15
    pthiel's Avatar
    Join Date
    Mar 2002
    Location
    Central Ohio
    Posts
    195
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    GreenHouse1, I was not in any way criticizing your post or your feelings on this, I truly understand and often get very frustrated with some of the people who post on the listserv. Having gone back through the archives and seeing firsthand some of the people that appear to have been run off or at least no longer post there due to the inconsiderate actions of others makes me wish that it was not an unmoderated list. That is what really helps make this site work, the time and attention of Phil & Jeff and all the moderators who give their time to ensure it stays friendly and posts are helpful not hurtful. If you took my post to in any way be a criticism of yours please accept my apology - it was not meant to be.

    Pyro - I caught who the lead poster over there was - you aren't in school to be a barrister are you?

    Cheers,

  8. #16

    Join Date
    Mar 2001
    Location
    texas
    Posts
    434
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Red face

    Oh Pyro....I'm so sorry! You go by Travis on there don't you? And you are gifted and clever too, and witty. [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img] (Not many of us are as verbally gifted as Tamlin) [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img]
    Thank you so much...I truly didn't mean to leave you out. Please just write it off to old age (mine, not yours).
    And Pthiel....no offense taken...you were just being factual...no problem.
    Next...and I'm not trying to cause any discussion on this....but
    While we're here...there was a mention about people not using their real names on here. For lots of us it's a matter of security rather than worrying about spam. Sad to say but in this nutty world some of us feel the need to stay a little private in public places. I really understand those who prefer to remain somewhat anonymous...especially in the cases of the young users.
    The opinions expressed here are not necessarily those of the management. And the management will be happy to hear that!

  9. Page 2 of 4 FirstFirst 1234 LastLast

    Tags for this Thread

    Posting Permissions

    • You may not post new threads
    • You may not post replies
    • You may not post attachments
    • You may not edit your posts
    •