User Tag List

Informational! Informational!:  0
Likes Likes:  0
Results 1 to 4 of 4

Thread: Smokewater...

  1. #1
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    So how does one use smokewater? I have a jar of it (from a friend) but I don't know exactly what I am supposed to do. Do I dilute? Do I soak the seeds? Do I spray them on their media?

    Anyone have a clue
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  2. #2
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Arrow

    Pyro,
    We had a different name for "smokewater" in college......
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  3. #3
    larry's Avatar
    Join Date
    Feb 2002
    Location
    Southern California
    Posts
    1,724
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    hehe, smokewater. Scholaty, wonder if homemade smokewater would work [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img]
    larry
    http://www.flickr.com/photos/bigflytrap/
    Save a tree, legalize cannabis.
    Be enlightened

  4. #4

    Join Date
    Dec 2001
    Location
    Oswego, New York, U.S.A.
    Posts
    5,290
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I only wish I could experiment along these lines.
    "Grow More, Share More"

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •