User Tag List

Informational! Informational!:  0
Likes Likes:  0
Results 1 to 5 of 5

Thread: European bred plants different from

  1. #1
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Unhappy

    Hi Everyone,
    My new friend Patrice (in France) and I were discussing an observation of his. It started out with sars, but it seems the same thing holds true with VFT's and at least SOME native N. American drosera (like angelica, for instance).
    Here is the observation:
    Quote
    here , most of the plants come from the same producers (most of them are from holland) , and the clones are all looking the same.
    and thoose leuco seedlings look very different from seedlings made with "our" european seed , seed that we produce ourselves.
    also , I have obtained some sarracenia plants the last week ; thoose plants came from "old" clones , imported 15 years ago in europe. and they look very different from our "holland" plants.
    for example , I've now an "old" s.flava clone , and the plant looks very different from our holland plants.....and it looks also different from the flava that I have !
    the hood of that old clone is much more longer than my holland one !
    [/QUOTE]--Patrice C.
    "here" means Europe. "those leuco seedlings" are in reference to some leuco seeds I sent to him ( if I remember right, I got them from Brooks).
    When Patrice referrs to and "old" clone, he means one from the States.

    some more observations:
    Quote
    I would be interrested because in my opinion, thoose "old" plants also look , somewere , more like real plants than thoose holland plants....;what i mean is that they look more healthier , more robust...the holland plants look something like "plastic plants" sometimes..they are strong , okay , but they are something different from thoose old plants. or I'm totaly blind , i dont know , maybe I'm wrong of course.
    [/QUOTE]
    and
    Quote
    for exemple , I grow mine outside since years , but the holland strains still look soft....and the "old" strains look stronger.[/QUOTE]

    We were tossing around the idea that maybe the differences are partly due to sunlight intensity that far north v/s where they actually grow, and other climactic conciderations like weather intensity. However, I don't this any climactic conditions would impact the size of a flava hood

    Can anyone shed some light on this mystery?
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  2. #2
    Far too old to grow up now. Kate's Avatar
    Join Date
    Aug 2002
    Location
    Vancouver Island
    Posts
    429
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    It could be as simple as the original plant(s) the clones were taken from. Even in my small collection I notice a difference between plants of the same species, some are just inexplicably stronger and more healthy than others. I have always thought is was just simple genetic drift.

    If you do come up with an answer please share, you have piqued my curiosity.
    I typo, therefore I edit.

  3. #3
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I would guess you are just dealing with a case of genetics here. Each plant or set of plants comes from a different genetic stock and so each will exhibit a variation in traits. You might also have a sort of inbreeding situaton where the European stock his weaker because there were not a lot of plants imported in the first place so all the plants are something like 'cousins.' Here in the States there are a lot more clones so the genetic mix is better.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  4. #4

    Join Date
    Dec 2002
    Location
    Munich/ Germany
    Posts
    348
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hi,

    the TC grown plants Patrice speaks of are produced for mass market here in Europe. Typical lifespan of any plant sold in a gardencenter is about 4 to 6 weeks only (According to insiders). The nurseries are looking for their profit, so they select those clones which grow fast and reach a sellable size in a minimal amount of time - and therefore minimal money. Of course the fastest growing one must not be the best one in the long run, but this is not so important for the sellers of gardencenter plants.

    Of course you can get a big variety of different clones from smaller nurseries - i.e. Mike Kings list might be unbeaten worldwide. Patrice lives in France where nurseries are scarce. here in Germany the situation is quite different. For example there are four different people producing Nepenthes in TC - more than I know of in the whole US...

    Joachim

  5. #5

    Join Date
    Aug 2001
    Location
    UK
    Posts
    543
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    One of the things I look for is diversity and variation in Sarracenia so the genetic mix of plants (from wild sourced material) is wide. In breeding of plants as per the examples mentioned is not the best way!
    Best Regards

    Mike King

    NCCPG National collection holder of Sarracenia

    http://www.carnivorousplants.uk.com

  6. Tags for this Thread

    Posting Permissions

    • You may not post new threads
    • You may not post replies
    • You may not post attachments
    • You may not edit your posts
    •