User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 2 of 2 FirstFirst 12
Results 9 to 13 of 13

Thread: Darcie

  1. #9

    Join Date
    Dec 2001
    Location
    Oswego, New York, U.S.A.
    Posts
    5,290
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Ahhhhhhhhhhhhh, a new member who is interested in Drosera species! Welcome to the forums!
    "Grow More, Share More"

  2. #10

    Join Date
    Jul 2002
    Location
    Milan-Italy
    Posts
    80
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hi and welcome Darcie !!
    You will find all the informations about sundew and others beautiful and amazing carnivorous plants in these forums.
    So have a good coltivation starting with the easy species and then go on with the more difficult one.

    Kind regards

    rajah

  3. #11
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Thumbs up

    Quote
    Ahhhhhhhhhhhhh, a new member who is interested in Drosera species![/QUOTE]

    Tamlin, I can hear you licking you chops all the way over here!! [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img]

    Darcie, welcome! [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img]
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  4. #12
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Darcie,

    Welcome [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]

    And since my name was mentioned I can not help but pip myself a little. I might not come close to Tamlin in Drosera knowledge but I have a bit and some plants too so feel free to drop me a line any time. And if you like Utrics too, so much the better [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  5. #13

    Join Date
    Mar 2002
    Posts
    1,866
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Welcome to the forums! There are alot of great people around here. You will be sucked in to the world of CP's - and for everything else there is MasterCard!

    travis [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]
    \"Some cause happiness wherever they go; others, whenever they go.\"
    -- Oscar Wilde

    http://www.nasarracenia.org/

  6. Page 2 of 2 FirstFirst 12

    Tags for this Thread

    Posting Permissions

    • You may not post new threads
    • You may not post replies
    • You may not post attachments
    • You may not edit your posts
    •