User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 2 of 3 FirstFirst 123 LastLast
Results 9 to 16 of 19

Thread: Dionea x drosera?

  1. #9
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Inter- is the correct prefix [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img] It is easiest to remember by analogy, think interstate (between states) [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  2. #10

    Join Date
    Dec 2001
    Location
    Oswego, New York, U.S.A.
    Posts
    5,290
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Love that atavar Pyro!
    "Grow More, Share More"

  3. #11
    Copper's Avatar
    Join Date
    Mar 2003
    Location
    Hastings NE
    Posts
    2,215
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I believe it has been done with success with fruits.
    I am just like a Super Hero, but without the power or motivation.................and the funky suit.

  4. #12
    Stay chooned in for more! Clint's Avatar
    Join Date
    Apr 2003
    Location
    Metro Atlanta Area
    Posts
    9,681
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    ok i've been away lately.

    i think its really cool!! is there anyway you could "make" the seeds germinate?

    speaking of orchids, i think its a shame that orchids are so much more popular than cp's. cp's look great all the time and orchids are only beautiful when in flower.

  5. #13
    Stay chooned in for more! Clint's Avatar
    Join Date
    Apr 2003
    Location
    Metro Atlanta Area
    Posts
    9,681
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Archive-Date: Sat, 12 Aug 2000 08:59:14 -0800
    Date: Sat, 12 Aug 2000 08:58:46 -0700 (PDT)
    Message-ID: <20000812.085503.-11307.3.bioexp@juno.com>
    Reply-To: cp@opus.labs.agilent.com
    Sender: cp@opus.labs.agilent.com
    From: Ivan Snyder <bioexp@juno.com>
    To: Multiple recipients of list
    Subject: re: Drosera regia - Dionaea Relation


    >Hey listserver,Does anyone know the chromosome count
    >on D.regia and D.muscipula.I think they are
    >related.The flowers and seed are very similar.In
    >D.muscipula the pollen is ready before the plant is
    >receptive.The same is true in D.regia.Sometimes I even
    >get the seed mixed up.Pretty soon I will make the
    >cross.Petiolaris Sean

    Jan:
    >They definietly are. Besides the morphological similarities, genetic
    >alignments place _D. regia_ (and not _D. falconeri_ or any other
    >Lasiocephala; Hi Ivan, I do not buy your theory - but I doubt you
    >believed I would, anyway&#33[img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img] at the very base of the genus _Drosera_,
    >quite close to _Dionaea_.

    Hi all, Ivan here,
    This is a subject I find especially interesting. In the 1985 CPN December
    issue I wrote the article 'Evolution of the Venus' Flytrap'. In the
    article I detailed the evolutionary steps from sundew to VFT. At the
    time, Drosera falconeri had recently been discovered. When I submitted
    the article, Joseph Mazrimas wrote me that he felt that D. falconeri
    might be an ancestor of VFT. After studying the plant myself, I do not
    believe this is true. Still, the similarity in my hypothetical drawing in
    the article, as Mr. Mazrimas suguested, is astonishing. This is why I say
    that D. falconeri is representative of a missing link, though not
    actually the genuine article.

    After much study I feel that D. regia is the most closely related sundew
    to VFT. In addition to the shared characteristics mentioned by Sean and
    Jan here are the pollen. D. regia pollen is unlike any other sundew and
    most like that of VFT. The chromosome counts are especially telling (if
    correct). In biology there is a general rule in respect to archaic
    species which have developed into more moderns and differing by one pair
    of chromosomes, such as this case, VFT = 32, D. regia = 34. The older
    species will actually have the higher count. This is because it is more
    simple to lose a pair rather than gain one. This rule holds true with the
    aboriginal horse having one pair of chromosomes more than the
    domesticated horse. Also consider the chimpanzee has one pair more than
    we Humans. Incedently, the wild horse ancestor and domestic horse may
    interbreed and often produce fertile offspring, despite the chromosome
    difference.

    I have tried cross pollinations of many different sundews with VFT. All
    will be surprised to hear that some did cross, though the hybrids did not
    survive long. I have not had flowering of D. regia and VFT simultaneously
    yet. I feel that maybe these two might be most compatible.

  6. #14

    Join Date
    Aug 2002
    Posts
    887
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    wow, truly amazing. William, I agree on Pyros avatar, it kinda resembles one of my hobbies... [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img] , i am a pyro myself i thank you,
    Kevin
    Kevin Peterson
    Grosse Pointe, MI

  7. #15
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Post

    Here's something else to throw in the mix...

    I read that recently a very close relationship (genetically) between aldrovanda and the VFT had been established....as if they were common children of one ancestor. Now THAT would be an interesting cross....
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  8. #16
    goldtrap2690's Avatar
    Join Date
    Sep 2002
    Location
    San Francisco
    Posts
    1,390
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    they once bred a heliamphora with a darlingtonia but the seedlings were very weak and they died so i think that dionaea with drosera regia is possible .

Page 2 of 3 FirstFirst 123 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •