User Tag List

Informational! Informational!:  0
Likes Likes:  0
Results 1 to 7 of 7

Thread: Color

  1. #1

    Join Date
    Jan 2003
    Location
    Gilbert, AZ
    Posts
    86
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    It seems to me that all cps turn red, pink, orange, purple, or some other redish color when they are in strong light (other than species that have been bred not to), is that true?
    I have also noticed on my d. spatulata that the leaves don't actually change from green to red: The new leaves that grow after the plant has been exposed to light are red, and the old leaves stay green. Is that true?
    And though the Heavens and the Earth pass away.

  2. #2

    Join Date
    Aug 2001
    Location
    San Francisco, CA
    Posts
    988
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Yes, intense light sometimes turn dew leaves darker, most likely in an attempt to gather more light. I have had some older leaves turn redish in intense light, but its mostly the newer ones coming from the middle.
    Taproot, Anti-Flag, The Casualties, Alkaline Trio, Eleventeen, Deadsy, AFI...what's not to love?

  3. #3

    Join Date
    Sep 2002
    Location
    Western MI USA
    Posts
    1,473
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Post

    Actually, I think they turn red because they can afford too. Normally they use red light to supliment the blue light that is gatherd for use in photosynthese. But if they have plenty of blue light, they don't need the red and can reflect it back without any loss of potential energy (all plants have a production threshold that can't be passed)... Granted I don't know why the plant prefers to be red over green or blue, but I would imagin it has something to do with attracting prey.
    There is no item greater in value than life, for without life value would cease to exist.
    My Grow List

  4. #4

    Join Date
    Feb 2002
    Location
    menomonie
    Posts
    1,101
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    In many cases the red coloration - in the form of veining - is to attract potential prey, to make it look like some piece of flesh. Some of those Nepenthes really look like hanging pieces of meat.
    Another thing I think I remember reading somewhere, and my memory may be skewed so I'm not 100% sure, but the anthocyanins that make the red color actually protect the plant from damage by the sun, or something to that effect - which is why the more sunlight a plant gets, the redder it will get.

  5. #5
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote (Darcie @ Mar. 08 2003,4:47)
    Actually, I think they turn red because they can afford too. Normally they use red light to supliment the blue light that is gatherd for use in photosynthese. But if they have plenty of blue light, they don't need the red and can reflect it back without any loss of potential energy (all plants have a production threshold that can't be passed)... Granted I don't know why the plant prefers to be red over green or blue, but I would imagin it has something to do with attracting prey.[/QUOTE]
    I am going to have to disagree with Darcie.

    The red wavelengths that plants utilize are not the same as the ones that get reflected back by anthocyanins. They are still using both red and blue light. Different forms of anthocyanins have metabolic gain and can contribute intermediates to the chlorophyll photosynthesis patway. However I believe their primary use is equivalent to melanin in human skin. Higher light usually means higher UV which is a DNA damaging agent (creates thymine-thymine dimers.) Anthocyanins absorb and reflect UV wavelengths and there by reduce the risk of mutagenesis.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  6. #6

    Join Date
    Sep 2002
    Location
    Western MI USA
    Posts
    1,473
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Lightbulb

    really? well, thats interesting (about wavelength varients). I origenally thought it was like a suntan, but why red? does it also reflect UV?... Wait, humans turn darker brown or black, that means we absorb more light o_O so our pygment ketches the light befor it makes it into the cell? is that how that works? And then Plants absorb everything but red because red is low frequency and doesn't bothing them? do I have this right yet or am I mixed up again?
    There is no item greater in value than life, for without life value would cease to exist.
    My Grow List

  7. #7

    Join Date
    Nov 2002
    Posts
    478
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Nice thread. I will chip in and say the red pigment is some times released after cell damage. In table grape we treated with ethylene prior to harvest. It is among other things an aging "hormone" or auxin, and as the cells break down, the red becomes visible. This is also used in apples. Perhaps we see a dual or even triple purpose in the release of the red pigment. Thus, it is possible that the increased light could be damaging cells, no enough to hurt the plant, but enough to cause the destruction of enough cells to release the requisit amount of sun protecting pigment.

    More information would be appreciated.

  8. Tags for this Thread

    Posting Permissions

    • You may not post new threads
    • You may not post replies
    • You may not post attachments
    • You may not edit your posts
    •