User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 2 12 LastLast
Results 1 to 8 of 14

Thread: The first battle of the fruit flies

  1. #1
    Moderator
    Join Date
    Jul 2001
    Location
    San Antonio, Texas; USA
    Posts
    2,363
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    At approximately 8:30 PM, in an apartment on the north side of San Antonio, a Human Delivery Unit removed the cover of his terrarium, removed the cover of his fruit fly culture (flightless) and shook said culture over the terrariums inhabitants.... so began the first fruit fly invasion.

    The battle was ferocious, the fruit fly hordes ran to an fro, wiggling here, wiggling there, but the denizens of this terrarium were ready.

    D. Adalae caught 5 on one leaf in the first pass... D. Spathulata, had 2 in sweet honeyed captivity on the awakening of the morning sun, but by and far the two colonies of D. Capensis were the heroes of the tank. When I woke up this morning.. oh the carnage... oh... the carnage...

    Capensis all over the tank are curled around their victims... and the survivors have gone to ground... making the tank their own no doubt, they have no idea that they, and their kids will be food too some day... and no idea that dangers lurk in the soil as well...

    muhah hah aha haaa....


    [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]
    \"Maybe in order to understand mankind, we have to look at the word itself: \"Mankind\". Basically, it\'s made up of two separate words - \"mank\" and \"ind\". What do these words mean ? It\'s a mystery, and that\'s why so is mankind.\" ~ Jack Handey

  2. #2
    Admin- I'm growing CPs in the Desert of Tucson, Az. adnedarn's Avatar
    Join Date
    Jul 2001
    Location
    Tucson, Arizona USA
    Posts
    8,432
    Mentioned
    6 Post(s)
    Tagged
    1 Thread(s)
    hey, verry cool. nice story too! [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img] how about some pictures of the said carnage? my plants are inside and not in a tank so i don't get to see this kinda thing. maybe one here and one there. THANKS!!!
    Andrew
    -Andrew
    Owner of TerraForums, FlyTrapShop.com, and cpforums.org.
    Support FlyTrapShop, support TerraForums! www.flytrapshop.com

  3. #3

    Join Date
    Sep 2002
    Location
    Ogden, UT
    Posts
    423
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    "dangers lurk in the soil.."[img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img]
    Signature.

  4. #4
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Thumbs up

    Hey Ram,
    You should write a book! [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/tounge.gif[/img]

    Very cool, though. Quite satisfying to see that, isn't it? Like after you cook a big meal, and all your guests have to unbutton their pants! [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img]
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  5. #5
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote (joseph @ Nov. 20 2002,10:04)
    "dangers lurk in the soil.."[img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img][/QUOTE]
    I believe that Ram was refering to his resident Utrics. If memory serves they would be U. calycifida and U. longifolia. Both have fairly large traps and will probably be feasting on fruit fly larvea before too long [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  6. #6
    Moderator
    Join Date
    Jul 2001
    Location
    San Antonio, Texas; USA
    Posts
    2,363
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    That would be correct mr. Pyro!

    Feast they will! [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]

    My capensis are drooling with digestive juices.. I LOVE THIS.

    oh, and no digital camera right now... sorry..



    \"Maybe in order to understand mankind, we have to look at the word itself: \"Mankind\". Basically, it\'s made up of two separate words - \"mank\" and \"ind\". What do these words mean ? It\'s a mystery, and that\'s why so is mankind.\" ~ Jack Handey

  7. #7
    BoooOOOOooooo!!!!! unknownclown's Avatar
    Join Date
    Aug 2001
    Location
    Edmonds WA
    Posts
    1,501
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Ram I just love it when you write! [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img] that is too funny!
    I am the weirdo who sits next to you on the bus!

  8. #8
    Moderator
    Join Date
    Jul 2001
    Location
    San Antonio, Texas; USA
    Posts
    2,363
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Thanks, I like to write.

    Can you believe my sundews are already uncurling? that was fast!

    The rest of the little buggers are shivering with fear in the media...
    \"Maybe in order to understand mankind, we have to look at the word itself: \"Mankind\". Basically, it\'s made up of two separate words - \"mank\" and \"ind\". What do these words mean ? It\'s a mystery, and that\'s why so is mankind.\" ~ Jack Handey

  9. Page 1 of 2 12 LastLast

    Posting Permissions

    • You may not post new threads
    • You may not post replies
    • You may not post attachments
    • You may not edit your posts
    •