User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 5 of 6 FirstFirst 123456 LastLast
Results 33 to 40 of 45

Thread: The plant gods play games

  1. #33

    Join Date
    Feb 2002
    Posts
    432
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I think its U.unifolia.

  2. #34
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    CP2k and Tristan get the prize (now I just have to figure out what the prize is LOL [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img] )

    It is indeed U. unifolia.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  3. #35
    Nepenthes Specialist nepenthes gracilis's Avatar
    Join Date
    Sep 2001
    Location
    Alexandria Bay, NY Z-5a
    Posts
    6,341
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    And that is what we would all kill for. hmm......neat I guess not much of a Utricularia fan but I do like Quelchii,Reinformis and Alpina.

  4. #36
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    You're a lucky so-and-so, you know that, right? [img]http://www.**********.com/iB_html/non-cgi/emoticons/tounge.gif[/img]
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  5. #37

    Join Date
    Oct 2001
    Location
    Bavaria, in the South of Germany
    Posts
    319
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Pyro,

    you have to post a picture (when it flowers). ;-)

    And I have to wait some days until I'm at home again to have a look at my "Taylor".

    Martin

    I travelled 10 weeks through Ecuador rain forest (and other South and middle-American countries) three years ago but couldn't find any CPs.
    But I didn't really search for them...

    Martin

  6. #38
    larry's Avatar
    Join Date
    Feb 2002
    Location
    Southern California
    Posts
    1,724
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I'm with Nep G., not too big on Utrics [img]http://www.**********.com/iB_html/non-cgi/emoticons/tounge.gif[/img]
    I'd rather kill for a nep [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img]
    larry
    http://www.flickr.com/photos/bigflytrap/
    Save a tree, legalize cannabis.
    Be enlightened

  7. #39
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Well you all might not fint it that impressive but to Utriphiles it is a holy grail type plant (IMHO)

    Martin,

    Once it gets going again I will post out some pics and when it flowers I will probably break my camera through too much use [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  8. #40

    Join Date
    Sep 2002
    Location
    Western MI USA
    Posts
    1,473
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Lightbulb

    So Pyro doesn't have a Pom pom, but does anyhow here? I would love to get that plant, it's so cool, but I've only seen photoes and sketches
    There is no item greater in value than life, for without life value would cease to exist.
    My Grow List

Page 5 of 6 FirstFirst 123456 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •