User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 6 12345 ... LastLast
Results 1 to 8 of 45

Thread: The plant gods play games

  1. #1
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    This has truely been an odd yet wonderful CP week for me. This weekend I got quite a few interesting plant including one that many would kill for. Then, on Monday, I was about to dump an old seed tray to make room when what do mine eyes see but a B. gigantea germinating. And to top it off, last night while checking over my Mexi-Pings I found a Drosphyllum sprout!! Don't ask me how it got there. [img]http://www.**********.com/iB_html/non-cgi/emoticons/wow.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/wow.gif[/img] So all in all I am quite the happy camper [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  2. #2
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Thumbs up

    [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img] Man, you gotta love that!
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  3. #3
    larry's Avatar
    Join Date
    Feb 2002
    Location
    Southern California
    Posts
    1,724
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    So what's this interesting plant that we'd kill for? [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]
    larry
    http://www.flickr.com/photos/bigflytrap/
    Save a tree, legalize cannabis.
    Be enlightened

  4. #4

    Join Date
    Sep 2002
    Posts
    825
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Pyro, what is the plant i might kill for hoppen it is Nepenthes
    George McKay

    In The End We are All Dead
    Florida

  5. #5
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hey Larry, George,

    I'd tell you but then I'd have to kill you [img]http://www.**********.com/iB_html/non-cgi/emoticons/tounge.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img]

    It isn't a Nep though, I can tell you that.



    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  6. #6

    Join Date
    Sep 2002
    Posts
    825
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hey Pyro, here's a lighter go play with yourself
    George McKay

    In The End We are All Dead
    Florida

  7. #7
    Nepenthes Specialist nepenthes gracilis's Avatar
    Join Date
    Sep 2001
    Location
    Alexandria Bay, NY Z-5a
    Posts
    6,341
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    A U.Tricolor flowering right? [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]

  8. #8
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote (GEORGE-CP @ Nov. 20 2002,3:18)
    Hey Pyro, here's a lighter go play with yourself[/QUOTE]
    Oh... Fire... Pretty... <reaches for flame> OUCH! [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img]

    NepG,

    Nope, my tricolor is still just growing like it normally does.

    The plant itself is very rare in cultivation (or everyone else who has it isn't talking because I have sent out more emails than I can count trying to find another grower to compare notes with.)



    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

    Page 1 of 6 12345 ... LastLast

    Tags for this Thread

    Posting Permissions

    • You may not post new threads
    • You may not post replies
    • You may not post attachments
    • You may not edit your posts
    •