User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 2 of 4 FirstFirst 1234 LastLast
Results 9 to 16 of 25

Thread: Alumni

  1. #9
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I am also one of the GW outcasts. I still check in on GW now and then but I am happier here and so devote my time here first [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  2. #10

    Join Date
    Mar 2002
    Posts
    1,866
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I never graduated from GW...darn it! [img]http://www.**********.com/iB_html/non-cgi/emoticons/tounge.gif[/img] I suppose the reason for that is I have never visited there site before...don't care to either.
    \"Some cause happiness wherever they go; others, whenever they go.\"
    -- Oscar Wilde

    http://www.nasarracenia.org/

  3. #11

    Join Date
    Jun 2002
    Location
    Illinois
    Posts
    302
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Now you can't even mention ********** when trying to trade through email on gw. I just got a "spam alert" and they wouldn't send my email, just because it happenned to mention that these forums are, well, "better". Luckily I managed to get around it. [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img]

  4. #12
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Carnivorous23,

    Yes that was what got me banned, I suggested someone come here to get info on Aldrovanda because no one on GW was growing it. I never said PFT was better (even though we all know it is [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img] ) or made any derogatory comments but Spike personally emailed me to inform me I was bannished.

    I suggest you stay on your toes because he might come after you even if you did manage to get around the filter this time.



    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  5. #13
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Since this topic seems to keep popping up I just want to add something as a Moderator.

    The Mods and Administrators here know this is a tight knit community and that we look out for each other. That said, we DO NOT condon acts or attacks against GW. There have been wars with them in the past but we have decided the best action to take against them is to ignore them. We feel this is better than any form of attack on GW which would only act to give Spike justification to call us cyber-terrorist.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  6. #14

    Join Date
    Jun 2002
    Location
    Illinois
    Posts
    302
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I supose that's true, and I'm sorry if it causes him whining even more over anything about/to **********.

    However, I don't really care if I get banned at this point, I'm kind of surprised it didn't happen before, since I've mentioned this forum every time I've traded seeds on GW for quite some time. [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img]

  7. #15
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Thumbs up

    I'm a grad, too. I still look there sometimes, just to see if there is anything good. I don't think I've posted there, though, since I've come here.

    Sarrencia, I think I know who you mean.....they use a lot of capital letters, right?
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  8. #16
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Carnivorous23,

    I don't think it will cause any problems (and please don't think my comments were directed at you. What you did was not an attack against GW [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img] )
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

Page 2 of 4 FirstFirst 1234 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •