User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 2 of 3 FirstFirst 123 LastLast
Results 9 to 16 of 18

Thread: Happy annniversary

  1. #9
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    It has been a grand year with you here. And I anticipate many many more
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  2. #10

    Join Date
    Sep 2002
    Location
    Central Coast of California
    Posts
    3,928
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hi Tamilin,
    I know I haven't known you long,(or anyone else [img]http://www.**********.com/iB_html/non-cgi/emoticons/tounge.gif[/img]) but you have truly helped me (and everyone else) ALOT with growing my plants!!!
    AND I have seen you give literally(sp?) hundreds apon hundreds of plants/seeds away! I am definatly(sp) a member of the Tamilin club! [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img] (not because you give away plants! )

  3. #11

    Join Date
    Mar 2001
    Location
    texas
    Posts
    434
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Congrats Tamlin!! You're the best! Your wisdom and humor keep all of us on track. I raise my glass to you also. Cheers!
    *
    * *
    xxxxxxxxxxxx
    xxxxxxxxx
    xxxxxx
    xxxx
    xx
    x
    x
    x
    xxxxx

    [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img]
    The opinions expressed here are not necessarily those of the management. And the management will be happy to hear that!

  4. #12
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Smile

    Hey Tamlin,
    1000 posts...wow....That's 1000 bits of info that keeps other people (well, me) from killing their plants...Thanks (my plants definately thank you too)!
    Cheers!

    << CHUG >>
    ...
    wait..I mean << sip >>....yeah, that's the ticket. [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img]
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  5. #13

    Join Date
    Oct 2002
    Location
    -
    Posts
    193
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Question

    continue same way Tamlin! [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img]
    I haven`t been here long time but that time whose I have been here doesn´t really gone in wain. [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]

  6. #14
    Moderator Joseph Clemens's Avatar
    Join Date
    Sep 2002
    Location
    Tucson, Arizona
    Posts
    2,539
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Glad to have met you. I appreciate your encouragement.

    Hope we keep on living our lives for these jewels of the plant world for a long time to come. . .
    Joseph Clemens
    Tucson, Arizona, U S A

  7. #15

    Join Date
    Jun 2002
    Location
    Cambridgeshire, U.K.
    Posts
    390
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Happy Anniversary Tamlin

    Always willing to share your knowledge, experience and CPs with novices and experts alike. You are a 5 star asset to PFT forums, I'm glad I've met you here too.

    Keep up your good work.
    Cheers

    Vic
    They say that money talks, but all it ever says to me is goodbye.

  8. #16

    Join Date
    Aug 2002
    Location
    Richmond Hill, Ontario, Canada
    Posts
    340
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Yippee.... who's treating for dinner? [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img]

    Congrats Tamlin! [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img]
    DOH&#33;

Page 2 of 3 FirstFirst 123 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •