User Tag List

Informational! Informational!:  0
Likes Likes:  0
Results 1 to 7 of 7

Thread: If you like pics

  1. #1
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    BestCP just released 300 new pics on their site. I just spent the last hour there. WOW
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  2. #2

    Join Date
    Dec 2001
    Location
    Oswego, New York, U.S.A.
    Posts
    5,290
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Incredible photo's here, I especially liked the Petiolaris Droserae!
    "Grow More, Share More"

  3. #3
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I was taken by the Utrics and Genlisea (of course) but also really intrigued by the 'White' VFT
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  4. #4

    Join Date
    Sep 2001
    Location
    BC, Canada (z8)
    Posts
    493
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I got some of the G. lobata x violacea free with my last order. I'm really looking forward to it flowering now. It's growing really fast too.

    I don't think the pic labelled "U. tridentata" is correctly IDed. Maybe they meant to write U. triflora?

  5. #5

    Join Date
    Mar 2002
    Location
    Ontario
    Posts
    1,341
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Indeed some very nice pictures... Are all U. biloba that blue

  6. #6

    Join Date
    Sep 2001
    Location
    Midlands UK
    Posts
    195
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Mine is! [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img]
    Ok, i'm just being snobby now! [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/tounge.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img]

  7. #7
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Lightbulb

    Woah! That white VFT really is something! Looks almost like a cave plant! How does it photosynthesize?

    Great gallery, too. I was able to I.D. the Ultric that I had based on the flower (I lost the little stick thingy with the name).
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •