User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 4 of 6 FirstFirst 123456 LastLast
Results 25 to 32 of 41

Thread: Technically which is best?

  1. #25

    Join Date
    Mar 2002
    Posts
    1,338
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I thought I was on subject... spring water, hops, barley, and a little fermentation... gulp, gulp, gulp... aaaahhhhh. [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]

    Sorry PingMan, just a joke.

    My real opinion... distilled is as pure as it gets... if you have the right distilling plant.


    Mmmmmm... moonshine.



    There's a tunnel at the end of the light...

  2. #26
    Moderator Joseph Clemens's Avatar
    Join Date
    Sep 2002
    Location
    Tucson, Arizona
    Posts
    2,539
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    That's okay.

    This discussion is actually pretty cool and water use is definitely related to CP, as this issue is rather central to the cultivation of CP and just about any other living creature on this planet.
    Joseph Clemens
    Tucson, Arizona, U S A

  3. #27
    Nepenthes Specialist nepenthes gracilis's Avatar
    Join Date
    Sep 2001
    Location
    Alexandria Bay, NY Z-5a
    Posts
    6,341
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote (PinguiculaMan @ Oct. 22 2002,7:44)
    One system I have, which I will utilize soon, is capable of producing 10,000 GPD of RO water.[/QUOTE]
    Glad I won't have the water bill for that system! [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img]

  4. #28
    Moderator Joseph Clemens's Avatar
    Join Date
    Sep 2002
    Location
    Tucson, Arizona
    Posts
    2,539
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    You are quite accurate, especially here in the desert where water is at a premium.

    Good thing too that I only need to operate it on an as-needed basis and after the system is complete and operational any "waste" water from the RO process will be collected in an underground storage tank and distributed via irrigation system to the other non-cp plantings on various areas of the property.
    Joseph Clemens
    Tucson, Arizona, U S A

  5. #29
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Mindmaze,

    You are correct, I misread your post. Blame it on my brain being fried from doing gene sequencing all day.

    I like Jeff's idea of a beer. Beer is good for you, it has salt and protein and sugar. Everything a growing body needs [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  6. #30

    Join Date
    Sep 2002
    Location
    Western MI USA
    Posts
    1,473
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Angry

    Quote (Pyro @ Oct. 23 2002,10:23)
    Mindmaze,

    You are correct, I misread your post. Blame it on my brain being fried from doing gene sequencing all day.

    I like Jeff's idea of a beer. Beer is good for you, it has salt and protein and sugar. Everything a growing body needs [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img][/QUOTE]
    I hate what booze does to people, but I'll keep my mouth shut. Anyways... what are you sequencing [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img]
    There is no item greater in value than life, for without life value would cease to exist.
    My Grow List

  7. #31

    Join Date
    Sep 2002
    Location
    Western MI USA
    Posts
    1,473
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Cool

    Okay, logic running full speed, you guys make more sence, my own logic makes more sence, and the info I had can go into the trash bin cause it don't match eather (I know plenty about how cells work, I just had this faulty data bit in their). So anywho, yah uh RO is probubly just fine cause rain water isn't 100% pure eather (even befor industrial revolution) and that worked for the plants [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img] I used distilled untill just recently, eh whatever, I got to go to class.
    There is no item greater in value than life, for without life value would cease to exist.
    My Grow List

  8. #32

    Join Date
    Sep 2002
    Location
    KANSAS
    Posts
    173
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I'll drink my R.O WATER because if it means I have to drink lead and chlorine along with the 'good' minerals, then I can do without it.

    Besides, R.O. isn't completely void of these things, it varies with the quality going in. This is from the pros who installed it. My R.O system is connected in which the outlet is through plastic lines installed with the system. They don't use your pipes.

  9. Page 4 of 6 FirstFirst 123456 LastLast

    Posting Permissions

    • You may not post new threads
    • You may not post replies
    • You may not post attachments
    • You may not edit your posts
    •