User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 2 of 2 FirstFirst 12
Results 9 to 16 of 16

Thread: Back

  1. #9

    Join Date
    Sep 2002
    Location
    Western MI USA
    Posts
    1,473
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote (purplesundew @ June 18 2003,02:16)
    Hi Darcie! Can you post the pic of the Beluga Whale? I've only seen them from the top while they're bumping me around while I'm trying to fish and I've never been able to get a good pic [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] That would be so cool to be able to actually see it in an aquarium where you could see the whole whale. I only get to see a bunch of white humps in the water LOL
    Sorry.. everyone else is talking about corn and I'm stuck on the marine life.. but we don't have any big aquariums like that here so it would be awesome to see pics [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img][/QUOTE]
    Well, it was the top part, but it turned sort of on it's side so it could see me and was very very talky, it's a cute picture, I'll see what I can do about uploading it.
    There is no item greater in value than life, for without life value would cease to exist.
    My Grow List

  2. #10
    Moderator
    Join Date
    Jul 2001
    Location
    San Antonio, Texas; USA
    Posts
    2,363
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    wow! I would suspect your ladybug winter problem has turned into an incredible boon during spring! That is awesome! Wish we had your problem, our winter corner bundles of joy are harvester mites (daddy long legs) ich.
    \"Maybe in order to understand mankind, we have to look at the word itself: \"Mankind\". Basically, it\'s made up of two separate words - \"mank\" and \"ind\". What do these words mean ? It\'s a mystery, and that\'s why so is mankind.\" ~ Jack Handey

  3. #11
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Darcie [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img] We missed you, glad you are back
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  4. #12
    apple rings.. what more can i say? FlytrapGurl's Avatar
    Join Date
    Feb 2002
    Location
    T-ville, Florida
    Posts
    2,619
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    YAY!!! You're back! ***throws colorful, metallic confetti around***

    Gee, I never even noticed you were gone, Darcie! LOL I'm just kidding [img]http://www.**********.com/iB_html/non-cgi/emoticons/tounge.gif[/img]

    Greetings,
    FTG
    Liquid Plummer
    Warning: Do not reuse the bottle to store beverages.

  5. #13

    Join Date
    Sep 2002
    Location
    Central Coast of California
    Posts
    3,928
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote (Darcie @ June 17 2003,10:43)
    Oh aquariums, right. Lets see, they had lots of different froggies, mostly poison arrow of various spiecies, but some treefrogs too. One neet section had different cockroach spiecies, some scopions and a giant millapeed. They had stuff like perhanna(sp?), all sorts of catfish spiecies, oh and a really cool electric eel tank with a series of lights hooked to it. That was cool because the lights would start out bright and get dimmer along the series as a way to measure the output of the fish. It would go up and down a little even though the fish didn't look like they where doing anything. They also had a similar machine hooked up that you could put your hand againced to see you resting electrical output. Lets just say we can't compeat, although it did strike me with an odd though, in the Move The Matrix, humans are used to power the machiens, why didn't they use electric eels insted, I bet eels would of complained less, lol!

    One of the newer parts was the coral reef exhibit. They had lots of cool critters, but my favoret where the garden eels. They are so amazingly cute! They come in all colors and burry their tails in the sand pretending to be plants. They look like little candy canes sticking out of the sand but with big cute eyes. Their is also a spot where they have a glass FLOOR and you can see the blue spotted rays and blue spotted sting rays swimming ballow you. The point was the blue spotted ray mimics the sting ray so well you can't tell which is which. They had a bunch of sharks, but most where fairly young, their was also a shark incubator that was back lit so you could see the embrios wiggling around in their eggs! They had Chambered Nautalis, but they where hidding and not real active when I was their [img]http://www.**********.com/iB_html/non-cgi/emoticons/tounge.gif[/img] Oh and these wierd fish called flashlight fish that have a bioluminesent bacteria that lives in their eye tissue, very bizar. It was cool.[/QUOTE]
    The fish that looked like piranhas were probably red bellied pacus [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img]
    Flashlight fish isn't their real common name, we see them at the warf here now and then, cause 200 feet out into the ocean theres a canyon, a little bigger than the grand canyon, it goes down two miles! [img]http://www.**********.com/iB_html/non-cgi/emoticons/wow.gif[/img]

  6. #14

    Join Date
    Feb 2003
    Location
    Seattle, WA
    Posts
    109
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Welcome back Darcie... what a newsletter! [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]

    I thought it was sweet that you put the (sp?) thing only on the word asparagus [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img]

    I was in Chicago last fall and I went to the Botanical Gardens in Highland Park, they had a few Sarracenia! [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]

    Purplesundew.... are you in Alaska or Oregon? I think I remember reading that you are from Alaska but had recently moved for school. There's an aquarium in Seward isn't there? I think it was finnished just after I moved from Anchorage to Seattle.
    Also, there's an amazing aquarium in Seattle, down on the waterfront. It was remodeled a few years ago... It's worth the time if you make it up to Seattle.
    HOLDEN
    ...No snowflake ever lands in the wrong place...

  7. #15
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Lightbulb

    Woah....that was a lot to absorb!

    Welcome back Darcie! Those whales are really cool, huh? My wife and I enjoyed becoming friends with a dolphin at Sea World...well, feeding it anyway. I love marine mamals! [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img]
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  8. #16
    It's been one of dem days BigCarnivourKid's Avatar
    Join Date
    Jun 2002
    Location
    I live in Chaffee County, Colorado, USA
    Posts
    3,673
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Careful guys, I think this could ba a Fake Darcie. The spelling is much better than Darcie usually posts [img]http://www.**********.com/iB_html/non-cgi/emoticons/wow.gif[/img] .

    Just teasing you Darcie [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img] . It is good to have you back and I'm glad you had such a great time in Chicago. The aquarium sounds like a lot of fun. There's something about water and it's many varieties of life that has always fascinated me.

    Something else that is good for killing weeds and is especially usefull in preparing new beds, is heavy duty black plastic. Thinner plastic like plastic trash bags will work in a pinch, but they tear easier and don't trap the heat to the ground as well as heavier (thicker) plastic. It literally cooks the weeds and any seeds that are in the top layer of soil. Just spread it over the area that you want to cook and leave it on for several weeks. The sunshine does the rest. Also, mulching around your asparagus will not only smother most weeds but help keep moisture in the ground.

    Welcome back [img]http://www.**********.com/iB_html/non-cgi/emoticons/alien.gif[/img]
    ---Steve Allinger---

    How come chicken fingers are bigger than buffalo wings?

    My Grow List

  9. Page 2 of 2 FirstFirst 12

    Tags for this Thread

    Posting Permissions

    • You may not post new threads
    • You may not post replies
    • You may not post attachments
    • You may not edit your posts
    •