User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 2 of 3 FirstFirst 123 LastLast
Results 9 to 16 of 18

Thread: As some of you have herd...

  1. #9

    Join Date
    Apr 2003
    Location
    Cambridge, MA, USA
    Posts
    818
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Best wishes. I thought you were going to announce quadruplets, with a heading like that (herd?)

    [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img]
    There's no 'a' in perlite.

    My Growlist
    NECPS.org - New England CP growers unite!

  2. #10

    Join Date
    Dec 2001
    Location
    Oswego, New York, U.S.A.
    Posts
    5,290
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Heres to Andrew Jr., future CP enthusiast and car afficianado. Congratulations to all three of you!
    "Grow More, Share More"

  3. #11
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Bravo! Congratulations! That's really exciting! [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img]
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  4. #12

    Join Date
    Mar 2002
    Posts
    1,338
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Grats... [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]
    There's a tunnel at the end of the light...

  5. #13
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    A word of abvice from the father of a 7 week old: Start catching up on your sleep now because you won't get more than 4-5 hours a night in a few months [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]

    Congratulations and enjoy the adventure
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  6. #14
    Copper's Avatar
    Join Date
    Mar 2003
    Location
    Hastings NE
    Posts
    2,215
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Congratulations!! Catch up on your sleep and enjoy your sanity now [img]http://www.**********.com/iB_html/non-cgi/emoticons/tounge.gif[/img] They are a joy and wonder.
    I am just like a Super Hero, but without the power or motivation.................and the funky suit.

  7. #15
    It's been one of dem days BigCarnivourKid's Avatar
    Join Date
    Jun 2002
    Location
    I live in Chaffee County, Colorado, USA
    Posts
    3,673
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote (Copper @ Oct. 20 2003,10:40)
    ...................enjoy your sanity now [img]http://www.**********.com/iB_html/non-cgi/emoticons/tounge.gif[/img] [/QUOTE]
    Most definitely. Remeber insanity is inherited! You get it from your kids [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img] !
    ---Steve Allinger---

    How come chicken fingers are bigger than buffalo wings?

    My Grow List

  8. #16
    Admin- I'm growing CPs in the Desert of Tucson, Az. adnedarn's Avatar
    Join Date
    Jul 2001
    Location
    Tucson, Arizona USA
    Posts
    8,432
    Mentioned
    6 Post(s)
    Tagged
    1 Thread(s)
    Thanks all for the kind words!!

    Casper: LOL! that's a great (but sad) story. Thanks for sharing it!

    Plant a kiss: Travis was a smart man turning down Bicalcarata, I also will turn my nose up at it. The name is basicaly in stone. A little later on in the pregnancy I should have permission to tell it. lol. only becuase we are not 100% sure about it yet.

    I think it would be cool to have him on feb 29th. I look at it this way. If the 28th is a thur and the 1st is a friday, where do you think the b-day will be? huh? huh yeah, you wish you had a leap year b-day huh? LMAO.

    D muscipula: heard. as we all know by now the topic cannot be corrected. I do spell check the messages I submit but not usally the topic. It wouldn't had picked it up any way as you have pointed out what a herd is. LOL.

    Tamlin: Andrew Jr. uhm yeah. lets not ok? [img]http://www.**********.com/iB_html/non-cgi/emoticons/tounge.gif[/img] but future CP enthusiast and car afficianado absolutley!! (you forgot chick checker outer... hahaha&#33[img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img]

    I do trust you all in the lack of sleep thing. But it shouldn't be too bad since I already only get about 5-6 hrs a night. (ecen on the weekends... [img]http://www.**********.com/iB_html/non-cgi/emoticons/mad.gif[/img] WHAT IS MY PROBLEM?? ) hahaha

    lol @ BCK

    Andrew
    -Andrew
    Owner of TerraForums, FlyTrapShop.com, and cpforums.org.
    Support FlyTrapShop, support TerraForums! www.flytrapshop.com

  9. Page 2 of 3 FirstFirst 123 LastLast

    Tags for this Thread

    Posting Permissions

    • You may not post new threads
    • You may not post replies
    • You may not post attachments
    • You may not edit your posts
    •