User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 2 of 3 FirstFirst 123 LastLast
Results 9 to 16 of 24

Thread: Tasting cp nectar

  1. #9
    larry's Avatar
    Join Date
    Feb 2002
    Location
    Southern California
    Posts
    1,724
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    The tiny nectar drops running along the length of pitchers are sweet, and kinda make your tongue numb a bit [img]http://www.**********.com/iB_html/non-cgi/emoticons/tounge.gif[/img]

    There's this super thick droplet of nectar that hangs from that weird nub thing on N. maxima lids, that thing is sweet and candylike [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img]

    Drosera dew has no taste, not slimey either. I have yet to lick a ping since there's always dead insects on the leaves [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img]
    larry
    http://www.flickr.com/photos/bigflytrap/
    Save a tree, legalize cannabis.
    Be enlightened

  2. #10
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Most Drosera are bland but D. multifida has a characteristic acid tang.

    Pings (or at least the Mexi-Pings I have licked) are also rather bland. The flowers on potosiensis are yummy though

    Neps ventricosa and khasiana are sweet with a hint of tartness.

    Sarrs are also pretty sweet but oreophila has a bit of muskiness to it.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  3. #11

    Join Date
    Mar 2003
    Location
    North Central Ohio
    Posts
    394
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Just don't eat too much of S. flava's nectar because it might cause you to fail a drug test!! [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img]



    -buckeye

  4. #12
    Nepenthes Specialist nepenthes gracilis's Avatar
    Join Date
    Sep 2001
    Location
    Alexandria Bay, NY Z-5a
    Posts
    6,341
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    maxima is quite the nectar guy in my gh. Larry yup, the best nectar is under that boss under the operculum. Rajah is a bit sweet too from it's leaves.

  5. #13
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Lightbulb

    Wow, I can tell from everyones' typing just how much nectar they've been drinking.... [img]http://www.**********.com/iB_html/non-cgi/emoticons/wow.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img]
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  6. #14

    Join Date
    Aug 2001
    Posts
    371
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    hm......fresh nectar might be good, but I think I'll stick with pure honey and pancake syrup. [img]http://www.**********.com/iB_html/non-cgi/emoticons/rolleyes.gif[/img]

  7. #15

    Join Date
    May 2003
    Posts
    102
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote
    The tiny nectar drops running along the length of pitchers are sweet, and kinda make your tongue numb a bit[/QUOTE]

    Probably due to whatever anaesthetics/nerve poisons are present. There is the alkaloid coniine (as in hemlock) in S. flava - here is a link to its OED definition

    Coniine

    Anyone know how much nectar constitutes a lethal dose (and how about some volunteers to find out)?

    Giles

  8. #16

    Join Date
    Mar 2002
    Posts
    1,866
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I knew some people were not buying cp's for thier bug problem but for the nectar cps produce.

    Quote
    Wow, I can tell from everyones' typing just how much nectar they've been drinking.... [/QUOTE]
    LOL [img]http://www.**********.com/iB_html/non-cgi/emoticons/tounge.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img]

    Got CP's,
    Travis
    \"Some cause happiness wherever they go; others, whenever they go.\"
    -- Oscar Wilde

    http://www.nasarracenia.org/

    Page 2 of 3 FirstFirst 123 LastLast

    Tags for this Thread

    Posting Permissions

    • You may not post new threads
    • You may not post replies
    • You may not post attachments
    • You may not edit your posts
    •