User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 2 of 3 FirstFirst 123 LastLast
Results 9 to 16 of 24

Thread: Tasting cp nectar

  1. #9
    larry's Avatar
    Join Date
    Feb 2002
    Location
    Southern California
    Posts
    1,724
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    The tiny nectar drops running along the length of pitchers are sweet, and kinda make your tongue numb a bit

    There's this super thick droplet of nectar that hangs from that weird nub thing on N. maxima lids, that thing is sweet and candylike

    Drosera dew has no taste, not slimey either. I have yet to lick a ping since there's always dead insects on the leaves
    larry
    http://www.flickr.com/photos/bigflytrap/
    Save a tree, legalize cannabis.
    Be enlightened

  2. #10
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Most Drosera are bland but D. multifida has a characteristic acid tang.

    Pings (or at least the Mexi-Pings I have licked) are also rather bland. The flowers on potosiensis are yummy though

    Neps ventricosa and khasiana are sweet with a hint of tartness.

    Sarrs are also pretty sweet but oreophila has a bit of muskiness to it.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  3. #11

    Join Date
    Mar 2003
    Location
    North Central Ohio
    Posts
    394
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Just don't eat too much of S. flava's nectar because it might cause you to fail a drug test!!



    -buckeye

  4. #12
    Nepenthes Specialist nepenthes gracilis's Avatar
    Join Date
    Sep 2001
    Location
    Alexandria Bay, NY Z-5a
    Posts
    6,341
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    maxima is quite the nectar guy in my gh. Larry yup, the best nectar is under that boss under the operculum. Rajah is a bit sweet too from it's leaves.

  5. #13
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Lightbulb

    Wow, I can tell from everyones' typing just how much nectar they've been drinking....
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  6. #14

    Join Date
    Aug 2001
    Posts
    371
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    hm......fresh nectar might be good, but I think I'll stick with pure honey and pancake syrup.

  7. #15

    Join Date
    May 2003
    Posts
    102
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote
    The tiny nectar drops running along the length of pitchers are sweet, and kinda make your tongue numb a bit[/QUOTE]

    Probably due to whatever anaesthetics/nerve poisons are present. There is the alkaloid coniine (as in hemlock) in S. flava - here is a link to its OED definition

    Coniine

    Anyone know how much nectar constitutes a lethal dose (and how about some volunteers to find out)?

    Giles

  8. #16

    Join Date
    Mar 2002
    Posts
    1,866
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I knew some people were not buying cp's for thier bug problem but for the nectar cps produce.

    Quote
    Wow, I can tell from everyones' typing just how much nectar they've been drinking.... [/QUOTE]
    LOL

    Got CP's,
    Travis
    \"Some cause happiness wherever they go; others, whenever they go.\"
    -- Oscar Wilde

    http://www.nasarracenia.org/

    Page 2 of 3 FirstFirst 123 LastLast

    Tags for this Thread

    Posting Permissions

    • You may not post new threads
    • You may not post replies
    • You may not post attachments
    • You may not edit your posts
    •