User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 2 of 3 FirstFirst 123 LastLast
Results 9 to 16 of 17

Thread: Purpurea confusion

  1. #9
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Ha! I though it looked like something other that a typical ssp 'Venosa'. Man, you are REALLY lucky to have such a gorgeous sar! Congrats on winning with it. Richly deserved!

    You guys should have seen this thing in the...er...flesh. It's quite large, and is just so red. Awsome speciman! The pic here doesn't really do justice to the color. I mean, the darn thing looks like blood!

    D. Muscipula, have you updated the NECPS sight with all the winners, etc? [img]http://www.**********.com/iB_html/non-cgi/emoticons/rolleyes.gif[/img]



    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  2. #10

    Join Date
    Apr 2003
    Location
    Cambridge, MA, USA
    Posts
    818
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    The 2003 NE CP Show Report

    Of course, Schloaty! Unfortunately, i don't have photos of all the winning plants (funny, that capensis took first in the sundew category though). Good thing i had old "Red Ruffles" there, or Jeff would have swept both Ceph and Sarrs!

    The color HAS improved in the plant - you can see it on the front row of the display stand, and it looks stunning. I hadn't noticed how much more rich its coloration has become. It happens to be the plant that modeled for the photo at the top of the NECPS web page. [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img]
    There's no 'a' in perlite.

    My Growlist
    NECPS.org - New England CP growers unite!

  3. #11
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    The plant is not 'Red Ruffles' as that is that cultivar is a CC clone and is not carried by AgriStarts. I know the origin of the AgriStarts plant and the plant in question is a typical S. purpurea ssp. venosa. The best way to tell ssp. purpurea from ssp. venosa is that ssp. venosa is somewhat pubescent while ssp. purpurea is totally smooth. There are also slight differences in the hood (ssp. purpurea has less wave to it) and the pitchers (ssp. purpurea is narrower, less recumbant and almost waxy in texture.)

    NepG,

    According to everything I have read on the subject S. rosea (or var. burkeii if you prefer) has pink flowers with some clones occasionally having the pale cream flowers. The flowers themselves are on a shorter stalk and are larger across than ssp. venosa and ssp. purpurea. S. purpurea ssp. venosa still has maroon flowers like ssp. purpurea. There is a great article in the CPN about this
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  4. #12

    Join Date
    Apr 2003
    Location
    Cambridge, MA, USA
    Posts
    818
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Thanks Pyro, that's very a good lead. I guess i'll have to relegate my little purp back to generic venosa status.

    As i understand it now, the only consistent difference between rosea and venosa is the flower color. True?
    There's no 'a' in perlite.

    My Growlist
    NECPS.org - New England CP growers unite!

  5. #13

    Join Date
    May 2003
    Posts
    1,265
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hey, you always have the option of making a cultivar yourself, if it warrants it.

    SF

  6. #14
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    D,

    Flower colour, flower size, flowering period, pitcher morphology and a couple other traits I can't remember are what was mentioned in the CPN article. I'll look it up when I get home this evening
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  7. #15

    Join Date
    Apr 2003
    Location
    Cambridge, MA, USA
    Posts
    818
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Just for the record, i got an email from Peter saying "As for S. purpurea red ruffles, we have the only plants in existence and have been unable to get it tissue cultured so far, but hope it will succeed in the future. Seeya. Peter "

    So, it's definitely NOT a 'Red Ruffles'. In fact, most of you have never seen a 'Red Ruffles' in person, neither.

    I must say my experience with growing ssp venosa is limited to this plant. In fact, i don't think i've seen more than one or two other plants in person. But if those who are more familiar with venosa think it's warranted, i could propagate it and distribute it and describe it as a cultivar. However, to the best of my knowledge this is the Agristarts clone, which means there should be LOTS more plants just like mine.

    Pyro, you say you know the origin of the Agristarts clone... was there multiple batches from seed, or are they all identical clones?
    There's no 'a' in perlite.

    My Growlist
    NECPS.org - New England CP growers unite!

  8. #16
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    D,

    I know the person who used to do the CPs for AgriStarts. When he left them they just continued with the stocks he left behind. I do not know for certain but I would be willing to bet that the venosa plants they have are originally from a batch of seed. If you like I can ask him though (it will be a while as I am not sure when I will next speak to him.)
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

Page 2 of 3 FirstFirst 123 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •