User Tag List

Informational! Informational!:  0
Likes Likes:  0

View Poll Results: New species poll - If you discovered a new species ...

Voters
48. You may not vote on this poll
  • 1. Name it after yourself.

    18 37.50%
  • 2. Name it based on one of its aspects.

    12 25.00%
  • 3. Other.

    18 37.50%
Page 1 of 4 1234 LastLast
Results 1 to 8 of 27

Thread: New species poll

  1. #1
    BoooOOOOooooo!!!!! unknownclown's Avatar
    Join Date
    Aug 2001
    Location
    Edmonds WA
    Posts
    1,501
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    If you discovered a new species of carnivorous plant would you:
    I am the weirdo who sits next to you on the bus!

  2. #2
    fatboy's Avatar
    Join Date
    Aug 2001
    Location
    Darwin, Australia
    Posts
    571
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    You're not allowed to name them after yourself, as far as I know?

    I named mine after my wife... got me loads of brownie points (which I managed to lose again pretty quickly&#33[img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img].

    Cheers, Troy.

  3. #3
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I would go Troy's route (but I'd try to keep my brownie points LOL)
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  4. #4

    Join Date
    Mar 2002
    Location
    Ontario
    Posts
    1,341
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Yeah. Use it as a leverage tool. "I name my flippin plant after you, so SMILE when we're in public!"

  5. #5
    BoooOOOOooooo!!!!! unknownclown's Avatar
    Join Date
    Aug 2001
    Location
    Edmonds WA
    Posts
    1,501
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    [img]http://www.**********.com/iB_html/non-cgi/emoticons/wow.gif[/img] GREG! haha Shame on you! [img]http://www.**********.com/iB_html/non-cgi/emoticons/wow.gif[/img]
    I think Id name mine after my daughter.
    I am the weirdo who sits next to you on the bus!

  6. #6

    Join Date
    Mar 2002
    Location
    Ontario
    Posts
    1,341
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Oh Shelly, you love it!

  7. #7
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Arrow

    Definately after the wife. I might actually get 24 hours of NOT being in trouble.... [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/tounge.gif[/img]
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  8. #8

    Join Date
    Aug 2002
    Posts
    887
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I think I found a new type of shrub, its a small runner type leaf that has only a few heart shaped leaves. I have found it in only one spot near my Grandma's house on a hillside, it only lives in a 5 foot area. I have looked everywhere in books and where i found it. I still have not found what it could be, I would name it after myself [img]http://www.**********.com/iB_html/non-cgi/emoticons/tounge.gif[/img] if it happend to be unregistered.
    Kevin

    P.S. I would name it Kevin's Heart, but Im not sure for the spieces name, most likely Kevinis Petersonii
    Kevin Peterson
    Grosse Pointe, MI

Page 1 of 4 1234 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •