User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 3 of 5 FirstFirst 12345 LastLast
Results 17 to 24 of 33

Thread: Nest of yellow jackets

  1. #17

    Join Date
    Mar 2002
    Posts
    1,866
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    On second thought I will just walk up at night and spray the nest instead driving up and spraying.
    \"Some cause happiness wherever they go; others, whenever they go.\"
    -- Oscar Wilde

    http://www.nasarracenia.org/

  2. #18
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    RAID makes a really effective wasp and hornet spray. I think it has a range of 25-30 feet. Go out at late evening, when it is cooler and the sun has set. FInd the nest and start spraying the entrance and a few inches around it. The instant you see one of them back off and spray from a distance. Repeat every couple days if necessary. By spraying the entrance you effectivly trap the nest into poisioning itself because the poision effects them every time they enter or exit.

    Or, if you are feeling suicidal and know exatly where the entrance is you can stick a hose in it and turn it on fill blast. You shred the nest, drown the larvae, most of the adults and if you are lucky the queen. Regardless after that much damage they usually move to a new location.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  3. #19

    Join Date
    Mar 2002
    Posts
    1,866
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Day 2: I made progress as I sprayed the hole/nest for about twenty seconds. I had two sprays (Ortho and Spectracide)one in each hand. I kept at it until I saw them coming out and ran back in the house *Wooooo*. I think I will have a better understanding of how to spray. Tomorrow should be a better day for killing. I doubt I killed the nest but it is a start. Thanks for all (I am using "all" because I do not want to leave people out [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img] ) the help. [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img] I know what schloaty means as you get a shot of adrenaline *Wooooo*! [img]http://www.**********.com/iB_html/non-cgi/emoticons/alien.gif[/img]

    Travis
    \"Some cause happiness wherever they go; others, whenever they go.\"
    -- Oscar Wilde

    http://www.nasarracenia.org/

  4. #20

    Join Date
    Jun 2003
    Location
    winchester va
    Posts
    332
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    As for pouring gas into the ground, it may be illegal, but what about all the chemicals spilled on the roads from improperly maintained vehicles that washes into the rivers? It is a nearly identical situation, besides where is that gas comes from in the first place??
    IF you can see the nest try this...
    I was in pa recently and had the misfortune of running into about a half dozen hornets nests, mean suckers. My dad restores cars and we used some really nasty stuff called Brakekleen. It is some really mean cleaner for car parts. Anywho, this stuff KILLS ON CONTACT. I mean knocks em down in mid air. NOTHING, and I mean NOTHING is like this stuff. If you can see the nest, use this stuff, it is about $2 a can at any car parts store. I had two hornets come right for me and I hit them once and they dropped. They will get back up to fly away, but won't make it very far...good luck

  5. #21

    Join Date
    Sep 2002
    Location
    Western MI USA
    Posts
    1,473
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Their are a lot of old sorta effective but not really meathoids out their, but I like my teachers, he set the mower over the hole and they all come out to attack it so you just leave it running for a while. It's sick, but it works.

    Edit: Okay, I'm sorry, but I have to fix some stuff, it's driving me nuts.

    #1. NOT yellowjackets, GROUND BEES or GROUND HORNETS. Please use proper animal names, the methoid of dealing with the animals varries, Yellow Jackets make their homes in holes in stuff, shelterd areas, hollow logs, pipes etc. Most have very small nest with just a few females working together, the ones known for major damedge are the type that often move into piping and have much much larger collenies.

    #2. You can NOT kill a ground bee nest with surfice treatment. Their tunnles are incredibly deap and even trying to flood them out with water is nere imposible because of all the saftey tunnles they have.

    #3. They are extreamly aggressive and should be approched with caustion, yellow jackets pail in comparison to the ground bee agretion.

    #4. Seriously, the lawn mower thing works well because eventually everyone but the queen comes out and she can't survive alone.

    #5. Be carfull, they have a back door somewere
    There is no item greater in value than life, for without life value would cease to exist.
    My Grow List

  6. #22
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Darcie,

    I hate to argue with you but Yellowjackets do burrow and they can built big nests. I have witnessed this on numerous occasions. I have no doubt that Travis knows what insect it is.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  7. #23

    Join Date
    Mar 2002
    Posts
    1,866
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Darcie:
    If you look on web pages (they even have picture of yellow jackets) and on spray bottles yellow jackets do borrow under ground. They also feed on meat which is proven as I had a steak yesterday and the darn yellow jackets were trying to eat the steak. Anywho...

    I have checked the hole and did not see any Yellow Jackets coming out. Although, I only checked for about 30 seconds or so but yesterday at this time they where coming and leaving the nest. I will do a check again around 5 or so. Then spray the living day lights out of the nest/hole tonight. [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img] I do not feel confident enough to go over and yell at them saying "YOU LOST!!!" that will come later [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img] .

    Travis

    PS
    I am still pumped from last spraying the nest...What a rush!!! [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]
    \"Some cause happiness wherever they go; others, whenever they go.\"
    -- Oscar Wilde

    http://www.nasarracenia.org/

  8. #24
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote
    I know what schloaty means as you get a shot of adrenaline *Wooooo*!
    [/QUOTE]
    and
    Quote
    I am still pumped from last spraying the nest...What a rush!!! [/QUOTE]

    I TOLD you! Just don't go chasing after lion and tiger and bears (oh my) now! LOL! [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/tounge.gif[/img]

    Darcie,
    I'm with these guys, sorry. I used to be a junior entomologist (before I discovered girls [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img] ). I had a nest in the ground for several years. I just told my family to stear clear, since they weren't close enough to the house to bother anyone. But they do burrow. There was a pre-existing hole, but there was also always a pile of dirt around the entrance where the workers dumped their payloads. They were definately yellowjackets.
    In your defense, I have also seen them nest in logs and other hidey-holes. However, they can number in the hundreds, not just a few individuals.
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

    Page 3 of 5 FirstFirst 12345 LastLast

    Posting Permissions

    • You may not post new threads
    • You may not post replies
    • You may not post attachments
    • You may not edit your posts
    •