User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 2 12 LastLast
Results 1 to 8 of 12

Thread: Targets logic

  1. #1

    Join Date
    Jan 2003
    Location
    Palm Springs, CA
    Posts
    840
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I went into Target today on lunch and went to their limited houseplant section. Usually there's wanna be bonzai and green capped lucky bamboo. With your assortment of unlabeled generic tropical folliage and a few bromeliads of course. Well, to my surprise I saw Sarracenia, apparently 'Judith Hindle'. The leaves looked pretty nice for a plant in target. Now, realize these are on the bottom shelf, basically on the floor in the middle of the store far far far away from the windows that don't exist. That's not really the shocker. These nice Sarracenia were in glass vases, being sold as house plants. Still not surprised...but, they labeled them as Cobra Lillies, and gave a whole story about Darlingtonia. Strange that such nicely cared for plants for once were completely mislabeled.

    My question is why would they sell these this time a year as houseplants? It makes no sense, not only will they probably just sit in a corner somewhere and not get enough light, but this time a year they should be getting ready for bed, not hanging out in front of the fire place. [img]http://www.**********.com/iB_html/non-cgi/emoticons/tounge.gif[/img]

    Makes no sense to me what so ever.

    So...I went to Lowe's and ended up getting a Darlingtonia. [img]http://www.**********.com/iB_html/non-cgi/emoticons/tounge.gif[/img] $12 bucks cheaper.
    Lithops care info: If you take care of it, it will die.

  2. #2
    scottychaos's Avatar
    Join Date
    Aug 2001
    Location
    Western New York, USA
    Posts
    2,970
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    it makes perfect sense!
    because the people packaging and selling these simply dont care that:
    its mislabeled
    it needs dormancy soon
    it wont get enough light
    it will get tap water
    it will die in 3 months.

    by then, the money will have been made, and the purchaser of the plant will NEVER bring it back after 3 months and complain, they will just assume they caused its death, they must have done something wrong..

    and you said the real darlingtonia was 12$ cheaper?!
    how much was the Judith Hindle?[img]http://www.**********.com/iB_html/non-cgi/emoticons/wow.gif[/img]

    were there any care instructions?
    I will to visit local targets soon and see if they have any!

    Scot

  3. #3
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    That's no surprise, I've seen S. purpurea labeled as "cobra plants" in a realy, honest to goodness nursery! My wife wouldn't let me chew them out....
    honestly.... [img]http://www.**********.com/iB_html/non-cgi/emoticons/rolleyes.gif[/img]

    As far as selling them this way, don't be too surprised. Scotty is propably right...They only care about the almights dollar. Also, with regards to dormancy, these are most likely tissue culture plants, and won't need it until next winter.
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  4. #4

    Join Date
    Jan 2003
    Location
    Palm Springs, CA
    Posts
    840
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Darlingtonia are $3 and the Sarracenia in the vase was $15, but i'm guessing $10 of that is for the vase. It just kind of hurts to see them like that. And if they start to die I doubt they'll even discount them.

    It's really sad since the plants look actually good to start with for once. Still don't think it's worth the price of the vase. [img]http://www.**********.com/iB_html/non-cgi/emoticons/tounge.gif[/img]
    Lithops care info: If you take care of it, it will die.

  5. #5
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I know there is a cultivar floating around called 'Cobra's Nest' that was specifically bred for its resistance to tap water and being occasionally dried out. Might that have been the beast you saw?
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  6. #6

    Join Date
    Jan 2003
    Location
    Palm Springs, CA
    Posts
    840
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    At Target? [img]http://www.**********.com/iB_html/non-cgi/emoticons/tounge.gif[/img] Geez, I wish. Nah, it did say cobra lilly. I'll double check though, any idea what the physical characteristics of cobras nest would be?
    Lithops care info: If you take care of it, it will die.

  7. #7
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Looks like a rubra from what I have heard but that could be hearsay. Might check the ICPS register of cultivars.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  8. #8

    Join Date
    Jan 2003
    Location
    Palm Springs, CA
    Posts
    840
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    S. x 'Cobra Nest' = S. rubra x purpurea

    Still apparently wants distilled or rain water. Might be slightly tollerant.

    It definately wasn't this one though. I'm just going to stick with it being 'Judith Hindle'. The lid and color patterns just seem to noticably similar.
    Lithops care info: If you take care of it, it will die.

Page 1 of 2 12 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •