User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 2 of 2 FirstFirst 12
Results 9 to 16 of 16

Thread: Abreveations (spelling)

  1. #9

    Join Date
    Sep 2002
    Location
    Central Coast of California
    Posts
    3,928
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Quote (nepenthes gracilis @ Oct. 16 2002,3:42)
    NY:New York
    NJ:New Jersery
    VA:Virginia
    PA:Pennslyvania
    [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img]

    AFK: away from keyboard
    SASE: self addressed stamped envelope
    subsp: subspecies
    lol: laughing out loud OR lots of laughs[/QUOTE]
    OR lots of luck [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img]

  2. #10

    Join Date
    Dec 2001
    Location
    Oswego, New York, U.S.A.
    Posts
    5,290
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Re: regarding
    i.e.: that is
    e.g.: example
    Sp. species
    ssp.: subspecies
    Var.: variety

    asap: as soon as possible
    AFAIK: as far as I know
    "Grow More, Share More"

  3. #11

    Join Date
    Feb 2002
    Location
    z11 Puerto Rico
    Posts
    507
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Exclamation

    FWIW: for what it's worth

    LMAO: laughing my a$$ off

    CUL8R: see you later
    http://homepage.mac.com/mindmaze128/...lood forum.jpg
    Joel Martínez
    San Juan, Puerto Rico, USA

  4. #12

    Join Date
    Mar 2002
    Posts
    1,338
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Here's a few for those who really want to know...

    Abbreviations

    [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]
    There's a tunnel at the end of the light...

  5. #13

    Join Date
    Mar 2002
    Posts
    1,866
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    aka - as known as
    MI - Michigan
    U.P. - Upper Peninsula

    travis - Masked Ninja [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img]
    \"Some cause happiness wherever they go; others, whenever they go.\"
    -- Oscar Wilde

    http://www.nasarracenia.org/

  6. #14
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Arrow

    My boss just reminded my of two I use frequenly:

    PIMA (pain in my a$&#036[img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img]
    and
    PITA (pain in the a$&#036[img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img]

    What I like about these is you can pronounce them, so you can call someone a PITA and they think you mean bread....heh heh heh [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img]
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  7. #15
    God must have an interesting sense of humor Wesley's Avatar
    Join Date
    Aug 2002
    Location
    Lafayette, IN
    Posts
    1,559
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Thanks guys, I now know what a lot of the abreviations are
    ~Wes~

    My plants are going green to save the environment

    My Growlist

  8. #16
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    AFAIK = As Far As I Know
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  9. Page 2 of 2 FirstFirst 12

    Posting Permissions

    • You may not post new threads
    • You may not post replies
    • You may not post attachments
    • You may not edit your posts
    •