User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 3 of 4 FirstFirst 1234 LastLast
Results 17 to 24 of 29

Thread: Greenhouse

  1. #17

    Join Date
    Jun 2002
    Posts
    1,272
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Post

    Where i come from, everyone wishes they were your age... [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img]
    I am back..

  2. #18
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Thumbs down

    Pyyyyrroooo!
    Old! Ha! [img]http://www.**********.com/iB_html/non-cgi/emoticons/mad.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/wow.gif[/img]
    You're a spring chicken! Almost 25 indeed!
    Make us 29's feel so old that the dead sea was just sick when we were born [img]http://www.**********.com/iB_html/non-cgi/emoticons/tounge.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img]

    Man, my fingers are creaking as I type! [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img]
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  3. #19
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Something about the fact that I think of it as being a quarter of a century makes me feel old. Maybe it is the use of the word century [img]http://www.**********.com/iB_html/non-cgi/emoticons/tounge.gif[/img]
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  4. #20

    Join Date
    Mar 2002
    Location
    Georgia
    Posts
    127
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    For my first greenhouse I sarted with a base of landscape timbers I used 3/4" pvc pipe to make a frame that looked like it would fit on a costagaa sp wagon. I took 1" pipe and cut it into 8-10" sections and drove them into the ground. I then placed the ends of the frame into them and drilled a hole through the pipes and into the landscape timbers. I covered the whole thing with plastic. Then my Husband came back from a camping trip and had a fit [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img] He then made frames for the ends.

    You can use cross venlation and shde cloths to help the heat down in the summer and water containers to help keep the heat in the winter. I think the water helps absorb the heat in the summer also. White floors also help to keep the temp. down. For extra heat retention in the winter you need two layers of plastic with an air pocket in between them. I have heard that you can also line them with bubble wrap.
    Marjorie

  5. #21

    Join Date
    Jun 2002
    Posts
    1,272
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Unhappy

    [img]http://www.**********.com/iB_html/non-cgi/emoticons/wow.gif[/img] hmmm... i'm a tenth of a century! [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]
    I am back..

  6. #22
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Those are some good ideas Magore. I hadn't thought of using water for thermo regulation.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  7. #23

    Join Date
    Oct 2001
    Location
    Pennsylvania
    Posts
    126
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hey guys, no talk of getting old-----we just get better!!!!!!!!! [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img] (I stopped counting but will say I've past you all so far)

    On the heat issue, I strongly suggest some method of ventilation. A solar or battery operated fan perhaps, since there is no electric. Leave sections at the roof area uncovered is possible too.

    On the cold issue, depends on the plants that you plan on. I would think plants in dormancy that can take the cold would be fine as they would be sheltered for the high winds and bitter cold. I would not try to grow tropicals in that condition though LOL. Remeber the sun does shine in the winter too and will provide some heat build during the day. But I would treat it more as a cold frame than greenhouse for the winter.

    My 2 cents----
    Linda in PA

  8. #24

    Join Date
    Mar 2002
    Posts
    1,338
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    A couple of links for you...

    greenhouse 1

    greenhouse 2
    There's a tunnel at the end of the light...

Page 3 of 4 FirstFirst 1234 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •