User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 2 of 3 FirstFirst 123 LastLast
Results 9 to 16 of 23

Thread: Pictures!

  1. #9
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    NepG,

    Get yourself a steam humidifier. It works a lot better than the heater in a jar thing and it'll warm stuff up for you. I used to run one of these when I lived in CO, I had my room (200 sq ft) up to 90 most days, even in the winter
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  2. #10
    Nepenthes Specialist nepenthes gracilis's Avatar
    Join Date
    Sep 2001
    Location
    Alexandria Bay, NY Z-5a
    Posts
    6,341
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Howdy Pyro,

    Hmm I have an ultrasonic is that the same thing? Or is a steam humidifier hot humid air

  3. #11

    Join Date
    Mar 2002
    Location
    Ontario
    Posts
    1,341
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Steam humidifer boils the water between a few electrodes, so it shoots up steam, hot steam. Thas all that I've got. Hehe...

    But like i said earlier. My max daytime temps are 70s for my amp... It's a cutting from Joel's, so I'm not sure that it is an issue of temperature... =/

    EDIT: Could it be light? It seems more viney than mine, and other's I've seen... Just a thought.

  4. #12

    Join Date
    Oct 2002
    Location
    -
    Posts
    193
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    N.bilcarata looks nice! [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img]

  5. #13
    Guest
    I think your light is low. I know that two flourecent tubes at 2 feet high don't provide enough light. Especialy, if the length and width of your growing area is relatively large. Just my two cents.

  6. #14
    Nepenthes Specialist nepenthes gracilis's Avatar
    Join Date
    Sep 2001
    Location
    Alexandria Bay, NY Z-5a
    Posts
    6,341
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Se those white reflective papers in the back though? Those reflect LOTS more light, beforehand the light as awfully low. [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img]

  7. #15
    fatboy's Avatar
    Join Date
    Aug 2001
    Location
    Darwin, Australia
    Posts
    571
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Nep G I don't think light can be it, I have seen amp in the deepest darkest jungles where it is nearly black all the time and it had pitchers.
    Amp and longifolia are the only two I know of that can take it like that.

    I would correct the temp first and see what happens.

    Cheers, Troy.

  8. #16
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Wink

    Hi Nep G.,
    If you do figure out what is causing the problem, let us know. I have the same problem. My Amp is just sitting there, doing nothing. All my other lowlanders are in the same tank, and doing great (well, the mirabilis is a little weak, but at least it's growing). [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/sad.gif[/img]
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

Page 2 of 3 FirstFirst 123 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •