User Tag List

Informational! Informational!:  0
Likes Likes:  0
Results 1 to 2 of 2

Thread: Forked sundew?

  1. #1
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Unhappy

    Hi Guys and Gals,
    Wondering if anyone can help me out here. I have a pot of D. Spatulata that I got over the internet. Nice, healthy plants making lots of babies [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img] .
    Questiong is: Two seedlings don't look like the other ones. They almost look like forked sundews of some sort... I think they are the result of seeds that fell in the pots before shipping, but I don't know how long they can take before the germinate. Does anyone know how long forked sundew seeds can just sit there?
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  2. #2
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Just moving this to the dew forum [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •