User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 4 1234 LastLast
Results 1 to 8 of 27

Thread: CPs in the Wild

  1. #1
    Guest
    Ok, maybe I'm a little naive here but it seems like alot of people have never seen CPs in the wild. Are they just that rare? Or are the spots hard to find? I never realized...

  2. #2
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Many of the US CPs are in areas that are way off the beaten track (after all howmany highways go through swampland?) they are on private land (NO TRESPASSING!! VIOLATORS WILL BE MOWED DOWN IN A HAIL OF BULLETS!&#33[img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img] or are in protected areas (or all three.)

    I am in Atlanta and am supposedly an hour from one of the largest stands of S. oreophila but I've never gotten up to it because no one will disclose the location. I have also been to Florida numerous times in the past 4 months but have yet to see anything other than U. gibba.

    I think another reason people don't see them is that the few people who know where they are will not disclose locations due to the high threat of poaching.
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  3. #3
    Guest
    Ok, just checking. I don't make it down to the lower 48 much so I really don't know what it's like. I guess I'm spoiled living in the middle of a sphagnum marsh that is covered with CPs. *laughter* I've got to be the only one in Alaska who thinks owning 7 acres of swamp land is great.... [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img]

  4. #4
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Arrow

    You mean they have swamps in Alaska? I was under the impression that would just look like a big, mucky ice cube! [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img]
    [img]http://www.**********.com/iB_html/non-cgi/emoticons/tounge.gif[/img]

    sorry...couldn't resist.....sitting here at work, counting the minutes....
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  5. #5
    Guest
    ha ha ha ..
    yeah, and one of the biggest problems keeping CPs is keeping them warm without melting the walls of your igloo! [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img]

    Ok, time for the "No Alaska is Not a Big Glacier" lecture..
    *laughter* Just kidding..

    Alaska actually has seven species of carnivorous plants; 2 Pings, 3 Utricularia, and 2 Drosera. I've made it my goal this summer to locate and photograph each one in the wild. In August I'll be driving all the way to the Arctic Ocean with my boyfriend who's a professional photographer in search of the last 2 we haven't found. [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]

  6. #6
    Moderator Schmoderator Fluorescent fluorite, England PlantAKiss's Avatar
    Join Date
    Aug 2001
    Location
    Richmond, Virginia/Zone 7
    Posts
    10,335
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I guess most people in the U.S. aren't lucky enough to live in areas of bogs, coastal plains or fields where CPs grow in the wild. Too much natural habitat has been destroyed or poached to make it "common". Like Pyro said, most are remote, protected or just plain long non-disclosed areas. I asked a VA expert if therewere any PUBLIC lands where one could view (and view only) CPs in their native enviroment and I was told "no". Now perhaps that answer was to make sure nothing got poached but it was disppointing...I'd like to photograph and enjoy...not destroy.

    BTW Purple...what kind of CPs are covering your 7 acres of swampland? Lucky you.

    Suzanne
    "Fox terriers are born with about four times as much original sin in them as other dogs." - Jerome K. Jerome

  7. #7
    Moderator Schmoderator Fluorescent fluorite, England PlantAKiss's Avatar
    Join Date
    Aug 2001
    Location
    Richmond, Virginia/Zone 7
    Posts
    10,335
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    oops...sorry...technical error!



    "Fox terriers are born with about four times as much original sin in them as other dogs." - Jerome K. Jerome

  8. #8

    Join Date
    Aug 2001
    Location
    UK
    Posts
    543
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hi Guys,
    Here in England, we have 3 Pings, 3 drosera, I forget exactly how many Utrics, but I think it is 3 and even naturalised Sarracenia purpurea ssp. purpurea and VFTs I have seen so many sites here all on public land, but some of the more isolated sites are under threat. I have witnessed the destruction of 4 small sites I discovered in 1980 were completly gone by 1992 due to forestry activities. But seeing CPs for the first time in the wild gives a thrill that you can't imagine!
    Best Regards

    Mike King

    NCCPG National collection holder of Sarracenia

    http://www.carnivorousplants.uk.com

Page 1 of 4 1234 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •