User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 5 of 6 FirstFirst 123456 LastLast
Results 33 to 40 of 48

Thread: Carnivory...what IS it?

  1. #33
    Moderator
    Join Date
    Jul 2001
    Location
    San Antonio, Texas; USA
    Posts
    2,363
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Pyro, I didn't think you were getting in a twist, it was just that in the old place (looks down, crosses chest to ward of demons) the first time I mentioned I was a creationist people were ready to burn me at the steak! No respect for dissenting opinions!

    Virus, one of the wonderful things about this place, is that as long as the main topic of a thread has been addressed, topic drift is allowed, and no one really cares. So yes, it's not about CP's at this point, but who cares? We are having fun discussing as friends, which is what General Discussion is for...

    Pretty neat stories huh? Basalisk... will have to look that up... You know i love reading the Honor Harrington series, and one of the ships in there, a super dreadnaught, is called Bellaphron, until MI2 I never knew he was a greek hero, and that his arch nemesis was Chimera... When I learned that, I studied it, now I wll study Basilisk, as it to, is a ship, actually, a station, in the books... interesting.

    [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]

    any how... on with life!
    \"Maybe in order to understand mankind, we have to look at the word itself: \"Mankind\". Basically, it\'s made up of two separate words - \"mank\" and \"ind\". What do these words mean ? It\'s a mystery, and that\'s why so is mankind.\" ~ Jack Handey

  2. #34
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Virus,

    The basalisk has a lot of different descriptions; the bird headed serpent was one, an 8-legged lizard is another and I have heard of a third where it was made of stone. Its powers were also quite varied; breath that would burn, the gaze that turned you to stone (this coupled with the serpent body makes me wonder if the basilisk is an evolution of the Gorgon myth,) a scream that could shatter a man.

    Ram,

    Shouldn't that be 'stake' and not 'steak' [img]http://www.**********.com/iB_html/non-cgi/emoticons/tounge.gif[/img] LOL

    I didn't think I was coming of as getting in a twist but I like to make sure I'm not offending anyone. And I can tell you that I don't have a problem with you being a creationist so long as you don't have a problem with me being an evolutionist and I can guarantee you that I will not try to force my dogma on to you and there will be no stake (or steak) burning from me either [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]

    Pyro
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  3. #35
    Moderator
    Join Date
    Jul 2001
    Location
    San Antonio, Texas; USA
    Posts
    2,363
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    hehh... perhaps I was typing a little fast?

    I have no problem with anyone being an evolutionist, or anything else for that matter... the only time it offends me is when STUPID people try to argue me away from my beliefs... takling with you is a blast, but I absolutely hate it when some person armed with high school biology tries to tell my how flawed my views are... then I have to whomp on him...

    cause as has been said, scientists test their hypothesis to reach their pre-concieved conclusions, pretty much all scientists that are good do this, as it is part of the scientific method. (Or what would the point of making a hypothesis be? [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img] )

    The simple fact of the matter is, in both the creationist and Evolutionist camps there are brilliant scientists, and bad scientists, people seeking truth, and people seeking dogma, people who are well balanced, and people who are fanatics...

    I tend to be pretty level headed when it comes to my science... so I consider myself to be armed with good science... for the most part... and when ignorant people try to get in a debate with me, I bombard them with so much information they just kind of whither back... hopefully, they will take a few months to study their beliefs.

    All I really ask of anyone, is that they learn how to think, not learn what people tell them to think. Both scientific viewpoints have valid science behind them, it does gaull me that only one side is presented as science, the other as religion... but hey, what's a boy to do.

    I am all about choices, so as long as people make informed ones, I am absolutely cool with it!
    \"Maybe in order to understand mankind, we have to look at the word itself: \"Mankind\". Basically, it\'s made up of two separate words - \"mank\" and \"ind\". What do these words mean ? It\'s a mystery, and that\'s why so is mankind.\" ~ Jack Handey

  4. #36

    Join Date
    Jul 2002
    Posts
    62
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    i got lost after yall two started arguing (pyro and rampuppy)
    i forget wich dinosaur it was, cuz i dont remember names well, but theres this bigger dinosaur, that, if fought against t-rex WOULD win in a fight, BUT this is if in an open field, t-rex seemed to live among trees, and if they fought there HE would win, though these dinosaurs lived millions of years apart, this other dinosaur i cant remember the name of, was bigger, and lived AFTER the t-rex, not related in any way,
    so in fact, the t-rex keeps its title as king, [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/tounge.gif[/img]

  5. #37
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    BBB,

    Velociraptor, in packs, could probably take down any other dinosaur.

    Spinosaurus (if you saw JP3 you know him) was actually longer that Rex but mass for mass Rex was still larger so a fight between them would probably be an interesting thing to watch

    Pyro
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  6. #38

    Join Date
    Jul 2002
    Posts
    62
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    ya in packs, lol t-rex in packs AHAHAHA, omg, lol, with the leader mutating and growing arms aahaha
    no this dinosaur in fight, was actually BIGGER than t-rex in weight also, but less ferocious

  7. #39
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Angry

    I think I know what Bigbaldbob is talking about. I seem to remember reading about them finding this ENORMOUS fossil in....I want to say North Africa? That looked like a giant t-rex but later turned out to be something different.
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  8. #40

    Join Date
    Jul 2002
    Posts
    62
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    ya i think u got it, i remember something about a sea on the middle of north america though, so the east and west were divided,
    aww forget it im confused [img]http://www.**********.com/iB_html/non-cgi/emoticons/tounge.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/tounge.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]
    edited by BigBaldBob --- at 7:46 pm
    ya i never watched JR3 yet [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img]
    i guess it might be time to rent it on video, is it out yet [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img]

Page 5 of 6 FirstFirst 123456 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •