User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 5 of 12 FirstFirst 123456789 ... LastLast
Results 33 to 40 of 95

Thread: Origin of your name

  1. #33
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Long story short: I lit myself on fire for a game.

    ***PLEASE NOTE***

    [B]All the disclaimers that you can think of apply to this statment. Do not try this at home. Paremtal supervision required. Not for use by anyone. Blah, blah, blah
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

  2. #34
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Thumbs up

    Pyro,
    you sound hot. [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img]

    Sorry. Very bad pun.

    Schloaty is what my friends called me at college. My last name is Schloat, which is unusual, and people have fun saying it (go figure). Anyway, most everyone in my fraternaty had an "y" stuck to the end of their names (except Jay, but he had one already anyway), hense I became Schloaty.

    Ahh, the good old days.... [img]http://www.**********.com/iB_html/non-cgi/emoticons/tounge.gif[/img]
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  3. #35

    Join Date
    Apr 2002
    Location
    Los Angeles, CA
    Posts
    809
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Well, mine comes from a discussion my friend and I had. She was having trouble in Calculus, so I stuck a very old (10 yr+) stamp/sticker with a cartoon spider on it with the word "wicked" above it. She swore it gave her good luck on her exams, and we both mentioned that we liked saying that word. I also liked saying the word "thistle" and thought they were pretty. I had to pass by thistles on the shortcut to school, so I said I'd probably be cussing "wicked thistles" from then on because that is a great way to describe the pokey things. Then we agreed that it would make an awesome email account name, since NOBODY would have taken that one already. That's about it, two words I like saying. Maybe a bit descriptive of myself, who knows? [img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img]
    A flytrap ate my homework!
    -Michelle

  4. #36

    Join Date
    Sep 2002
    Location
    Central Coast of California
    Posts
    3,928
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    bump

  5. #37

    Join Date
    Mar 2002
    Location
    South London, UK.
    Posts
    69
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    No
    One
    Likes
    Us

    It's part of a football song from a team that I support.
    Paul O'Keeffe.

  6. #38

    Join Date
    Dec 2002
    Location
    Upper Maryland
    Posts
    318
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)

    Arrow

    Well, I wanted to use my actual name for PFT. But I couldn't. Why you ask? Because my name is Mike King. Yep. Mike King. So I thought about some of the stuff I liked and the first thing that popped up was monkeys. I didn't want to be looked upon as a child, even though I'm only 13, so I used Monkey"man". I'm sure a couple people caught on anyway. [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img]

    Mike [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]

  7. #39
    Moderator Schmoderator Fluorescent fluorite, England PlantAKiss's Avatar
    Join Date
    Aug 2001
    Location
    Richmond, Virginia/Zone 7
    Posts
    10,335
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    PlantAKiss...it was already my AOL screen name so I used it here. The name was kind of a play on words...being a gardener and having plants...combined with the thought that sometimes something as simple as a kiss, nutured with love and caring, can grow into something wonderful...just as plant does with proper care.

    My real nick is Dooz...so I answer to two names. Or...just say "hey stupid!" and I might come a-runnin'. [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]

    Suzanne/Dooz/PAK
    "Fox terriers are born with about four times as much original sin in them as other dogs." - Jerome K. Jerome

  8. #40

    Join Date
    Feb 2003
    Posts
    55
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I just came up with mine because the screen names I used to always use were always taken (ie. Vortex). It's derived from the latin words Terra (earth) and Phage (consume or internalize), so I suppose literally it means "earth eater". But symbolically it represents how I try to incorporate as much about nature and the environment into my life as possible.

Page 5 of 12 FirstFirst 123456789 ... LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •